ID: 1074550096

View in Genome Browser
Species Human (GRCh38)
Location 10:114434753-114434775
Sequence TCATATGCACGCACGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074550092_1074550096 13 Left 1074550092 10:114434717-114434739 CCTCATCTAACTCACGTCGGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1074550096 10:114434753-114434775 TCATATGCACGCACGTGTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 42
1074550091_1074550096 14 Left 1074550091 10:114434716-114434738 CCCTCATCTAACTCACGTCGGGA 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1074550096 10:114434753-114434775 TCATATGCACGCACGTGTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074550096 Original CRISPR TCATATGCACGCACGTGTTG GGG Intronic
917482224 1:175422382-175422404 ACATATACACACACGTGATGTGG + Intronic
919687043 1:200493434-200493456 TCAGATGCACGTATTTGTTGCGG - Intergenic
1063259619 10:4371812-4371834 TCATAGGCACGCACGTCTACAGG - Intergenic
1067848542 10:49740779-49740801 TCATAGGCACACACGTCCTGCGG + Exonic
1074550096 10:114434753-114434775 TCATATGCACGCACGTGTTGGGG + Intronic
1080985087 11:37453559-37453581 TCATATGCAATCACATGTTTAGG - Intergenic
1085839302 11:79992754-79992776 TCATGTGCACACACGTATGGGGG + Intergenic
1086600835 11:88631244-88631266 TCATATGCATGTAGGTGTTTTGG - Intronic
1087727765 11:101741712-101741734 TCAAGTGCACGCAGGAGTTGAGG - Intronic
1094305646 12:29016406-29016428 TTATATGGACTCAGGTGTTGTGG - Intergenic
1095978139 12:47953902-47953924 TCATATGCAGGAACGGGATGAGG - Intergenic
1102015665 12:109646295-109646317 TCACATGCACCCACGTGGTAAGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1112496302 13:99907860-99907882 TCATATGAAACCACGTGCTGCGG - Intergenic
1120867482 14:89308410-89308432 GCAGATGCACGCACTTGCTGTGG + Intronic
1122343649 14:101044908-101044930 CCACATGCACGCACCTGGTGCGG - Intergenic
1127333003 15:57956805-57956827 GCTTCTGCACGCACTTGTTGGGG + Intronic
1134628752 16:15741666-15741688 TCAGCTGCACGCAGGTGGTGGGG + Exonic
1147734698 17:42628352-42628374 TCATATGCACACATATGCTGGGG + Intergenic
1149252187 17:54783250-54783272 TCATGTGCACGCATGTGCTCAGG - Intergenic
1152575439 17:81138398-81138420 GTATGTGCACGCACGTGTGGGGG - Intronic
1156369316 18:36458445-36458467 TGATATGCACACACTTGTAGAGG - Intronic
1160362831 18:78298218-78298240 TCATCTGCACCCACGTGAGGTGG + Intergenic
1162826414 19:13255100-13255122 TCATAAGCACGATGGTGTTGAGG + Exonic
1163362953 19:16859550-16859572 TCTCAGGCATGCACGTGTTGGGG + Intronic
1163419296 19:17205279-17205301 TCTTGTGCACGCACTTCTTGTGG - Exonic
1164407909 19:27971084-27971106 TCATATGCACTGATGTGTGGGGG - Intergenic
926631643 2:15142080-15142102 TCATCTCCACCCACGTGTTGGGG + Intergenic
942484993 2:176429440-176429462 GCACATGCACGCACTTGTGGTGG - Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
956575246 3:70745398-70745420 CCATATGCAAGAATGTGTTGTGG - Intergenic
962501651 3:136000193-136000215 TCATATGGTGGCATGTGTTGGGG - Intronic
977498500 4:97806869-97806891 TCATATGCACTTATGTTTTGAGG - Intronic
992522267 5:77566636-77566658 ACATATGCACGCTTGTGTGGTGG + Intronic
1003974752 6:11331725-11331747 TCATATGGCCACACTTGTTGTGG + Intronic
1010364756 6:75037362-75037384 TCATATGCATGCAAGTGTACAGG + Intergenic
1013959663 6:115883892-115883914 TCAAAAGCACAAACGTGTTGGGG + Intergenic
1015395237 6:132726725-132726747 TCATGTGCATGCTGGTGTTGTGG + Exonic
1029414222 7:100432993-100433015 TCAGATGCACCCACTTGGTGAGG - Exonic
1035374184 7:158396481-158396503 TCACATGCATGCACATGTGGAGG + Intronic
1037758321 8:21725808-21725830 TCAGAGGCATGCACATGTTGGGG + Intronic
1045211797 8:100106607-100106629 TGATGGGCACACACGTGTTGGGG - Intronic
1048973693 8:139659156-139659178 TCGTATCCACGCAGGTGTTTAGG - Intronic
1050850762 9:10283103-10283125 ACATATGCAGGCAGGTTTTGAGG - Intronic