ID: 1074556396

View in Genome Browser
Species Human (GRCh38)
Location 10:114494973-114494995
Sequence TGCCTTACAGGATTGATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074556396_1074556400 8 Left 1074556396 10:114494973-114494995 CCCCTCATCAATCCTGTAAGGCA No data
Right 1074556400 10:114495004-114495026 TATGATTATTTACATCAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074556396 Original CRISPR TGCCTTACAGGATTGATGAG GGG (reversed) Intronic