ID: 1074556396 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:114494973-114494995 |
| Sequence | TGCCTTACAGGATTGATGAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074556396_1074556400 | 8 | Left | 1074556396 | 10:114494973-114494995 | CCCCTCATCAATCCTGTAAGGCA | No data | ||
| Right | 1074556400 | 10:114495004-114495026 | TATGATTATTTACATCAACGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074556396 | Original CRISPR | TGCCTTACAGGATTGATGAG GGG (reversed) | Intronic | ||