ID: 1074566346

View in Genome Browser
Species Human (GRCh38)
Location 10:114581764-114581786
Sequence GACAGGTCCCAGAACTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074566346_1074566351 7 Left 1074566346 10:114581764-114581786 CCATGAAAGTTCTGGGACCTGTC 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1074566351 10:114581794-114581816 CTCCTCATTTCCAGTGATGAGGG No data
1074566346_1074566350 6 Left 1074566346 10:114581764-114581786 CCATGAAAGTTCTGGGACCTGTC 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1074566350 10:114581793-114581815 CCTCCTCATTTCCAGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074566346 Original CRISPR GACAGGTCCCAGAACTTTCA TGG (reversed) Intronic
900033690 1:389538-389560 GAGAGGTCCCAGGACTTTCCTGG + Intergenic
900054524 1:619428-619450 GAGAGGTCCCAGGACTTTCCTGG + Intergenic
901753352 1:11425780-11425802 CACAGGTCCTAGACCTTTCTAGG - Intergenic
902453605 1:16515537-16515559 CACTGGTCTCAGAACTGTCATGG - Intergenic
902473660 1:16668201-16668223 CACTGGTCTCAGAACTGTCATGG - Intergenic
902485143 1:16739241-16739263 CACTGGTCTCAGAACTGTCATGG + Intergenic
908555823 1:65255344-65255366 GGCAGGTCCCCGAGCTTCCATGG + Intronic
910762964 1:90753075-90753097 CTTAGGTCCCAGATCTTTCAAGG + Intergenic
912432292 1:109635067-109635089 GACAGGTCCCAAACCTTGGAAGG - Intergenic
912899470 1:113632389-113632411 TAAAGCTCCCAGAATTTTCACGG - Intronic
913500685 1:119470119-119470141 AACAGGTACCAGGACCTTCAAGG + Intergenic
915555463 1:156658477-156658499 GACAGTTCCCAGAATCTCCATGG - Intronic
920530423 1:206697885-206697907 GACAGGTCCTAGGACTTGCTTGG - Intronic
922256047 1:223893693-223893715 GAGAGGTCCCAGGACTTTCCTGG + Intergenic
923724182 1:236492110-236492132 GGCAGGTCCCCGAAGCTTCATGG + Intergenic
924337248 1:242996560-242996582 GAGAGGTCCCAGGACTTCCCTGG + Intergenic
1063165881 10:3461979-3462001 GATGGGTCCCAGATCTTTTATGG + Intergenic
1064350013 10:14568057-14568079 GCCAGGGGCCAAAACTTTCAAGG + Intronic
1065293702 10:24255442-24255464 GACTGCTCCCAGAACATTAAAGG + Intronic
1067702815 10:48585925-48585947 CACATGGCCCAGGACTTTCAAGG + Intronic
1067741106 10:48896775-48896797 GACAGGACTCAGACCCTTCATGG - Intronic
1068030286 10:51698050-51698072 GACAGGTCCCAGGCATTTCAGGG - Exonic
1068227485 10:54124815-54124837 GAAAGGTTCTAGAAATTTCAGGG - Intronic
1069072672 10:64005758-64005780 GAGAGGTCCCAGACCTCTAAGGG + Intergenic
1069721352 10:70551473-70551495 GACTGGTCCTAGAACATTCCCGG - Intronic
1072898937 10:99390572-99390594 GACAGATCCCAAAACTATCAAGG - Intronic
1073305917 10:102503548-102503570 AAAAGGTCCCTGAAATTTCAAGG - Intergenic
1074566346 10:114581764-114581786 GACAGGTCCCAGAACTTTCATGG - Intronic
1074762511 10:116677492-116677514 GACAGGCCCCAGAACTGTGCAGG + Intronic
1076098479 10:127753844-127753866 GATAGTCCCCAGAACTTTTAGGG - Intergenic
1077228530 11:1448680-1448702 AACTGGACCCAGAGCTTTCAGGG - Intronic
1077420410 11:2447367-2447389 GACAGGACCCAGAACTGGAAAGG - Intronic
1081980076 11:47260741-47260763 AACAGGTGCCTGAACTTGCAGGG + Intronic
1082930628 11:58600976-58600998 GACAGGTCCCAGGATTATGAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1090917444 11:131178006-131178028 AACAGGTCCTAAAGCTTTCATGG + Intergenic
1097614970 12:61872748-61872770 GACAGGTGGGAGAACCTTCATGG - Intronic
1098956701 12:76695989-76696011 GACAGGTCCCAGGACTAACCAGG - Intergenic
1101032818 12:100676900-100676922 GCCAGGATACAGAACTTTCAGGG - Intergenic
1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG + Intronic
1105074121 12:133260373-133260395 GATAGGTCCTAGAACTGACAAGG + Intergenic
1105542032 13:21324226-21324248 GCCAGGTCCCAGAGCTTTTTGGG - Intergenic
1108321526 13:49295306-49295328 GACATGAGCCAGAACTTTCCTGG + Intergenic
1111405498 13:87799089-87799111 AGAGGGTCCCAGAACTTTCAAGG - Intergenic
1112382894 13:98909793-98909815 GTCAGGACCCAGCAGTTTCACGG - Intronic
1114776734 14:25492459-25492481 GACAGGTCAGAGATATTTCAAGG + Intergenic
1115070428 14:29315977-29315999 GACAAGTCCCATAATATTCAGGG - Intergenic
1115910744 14:38254760-38254782 GACAAGCCCCAGTACTGTCATGG + Exonic
1116642153 14:47477899-47477921 GACAGGTGCCTTAACCTTCAGGG - Intronic
1119407461 14:74407539-74407561 TACATGTCCCAGAACGGTCATGG - Exonic
1119967709 14:78935399-78935421 GACTGGTTCCAGAACTTCAAAGG + Intronic
1124065345 15:26338040-26338062 CACAGGTCCCAGAAAGTTAAAGG - Intergenic
1131620668 15:94065036-94065058 GAGAGATCACAGACCTTTCAGGG + Intergenic
1133831675 16:9329220-9329242 GAAAGGTTCCAGAACCTTAAGGG - Intergenic
1135352501 16:21740835-21740857 GACAGCTCCCAGCAGTTCCACGG - Exonic
1135450989 16:22556957-22556979 GACAGCTCCCAGCAGTTCCACGG - Intergenic
1137374590 16:47941771-47941793 CACAAGTACCAGAATTTTCAAGG - Intergenic
1138191356 16:55016635-55016657 GACAGCTCCCAGAATTTAAAGGG + Intergenic
1139229388 16:65268611-65268633 GACTTGTACCAGAACTTGCAAGG + Intergenic
1140299000 16:73738147-73738169 AACAGGTCCCCAAACTTACAGGG - Intergenic
1142235187 16:88918722-88918744 GAAATGTCCCAGAAGTTCCATGG + Intronic
1144804415 17:17954898-17954920 GAGAGGTCCCAGAACCTCCATGG + Intronic
1152553499 17:81041288-81041310 GACAGGCCCCAGAGCCTCCAGGG - Intronic
1152785097 17:82243593-82243615 AACCGGACCCAGAACCTTCACGG - Exonic
1154445516 18:14432337-14432359 GACAGTTCCCAGAAAAGTCAAGG - Intergenic
1155251183 18:23954599-23954621 GACAGGCCCCTGGACTTCCAAGG - Exonic
1156137266 18:34057557-34057579 GATAGATCACAGATCTTTCAGGG - Intronic
1156617143 18:38800337-38800359 GACAGACTCCAGAACTTTGATGG - Intergenic
1159165606 18:64695130-64695152 GTCAGATCCTAAAACTTTCATGG + Intergenic
1161496789 19:4590930-4590952 GACCGGGCCCAGAACTGTCCAGG + Intergenic
1166857704 19:45791558-45791580 GACGGGTCCCAGAACTGTGGCGG - Intronic
1202705850 1_KI270713v1_random:23276-23298 CACTGGTCTCAGAACTGTCATGG - Intergenic
926352510 2:12009410-12009432 AACAGGTCCCAGAAGTCCCAGGG - Intergenic
929804156 2:45129939-45129961 AAGAGGTCCAAGAACTTTCCAGG - Intergenic
931106745 2:59065242-59065264 GAAAGGTCCCAGACCTTTAAGGG + Intergenic
931483163 2:62663562-62663584 GACAGAACCCAGAACTTGCTTGG + Intergenic
931500078 2:62855620-62855642 GACAGAGCCCAGGGCTTTCATGG - Intronic
932701259 2:73993444-73993466 GACAGCTCCTCAAACTTTCATGG - Intronic
936069731 2:109358021-109358043 GACAGGTCAGAGGATTTTCAGGG - Intronic
936642602 2:114332057-114332079 TACATGTCTAAGAACTTTCATGG - Intergenic
937896537 2:126980463-126980485 GGCAGGTACCAGATCTTACAGGG - Intergenic
938189681 2:129265113-129265135 GCCAGGACCCAGAAGTGTCATGG + Intergenic
938381710 2:130839827-130839849 GGCAGGTCCCTGTATTTTCATGG + Intronic
940298664 2:152156993-152157015 AGCAGGTCCCAGATCTTTGAGGG + Intronic
941283776 2:163583843-163583865 GACAGGTTCCTGCATTTTCATGG - Intergenic
942045751 2:172098417-172098439 GAAAGGCCCTAGCACTTTCAGGG + Intergenic
946337069 2:219044968-219044990 GCCAGGACCCAAAACTGTCAGGG + Intergenic
1169184189 20:3599391-3599413 GAAAGGTCCAAATACTTTCATGG - Intronic
1177714573 21:24822545-24822567 CACAGGACCCAGAACACTCAGGG - Intergenic
1179022609 21:37653990-37654012 GGCTGGTTCCAGAACTTTCTAGG - Intronic
1184215191 22:43062026-43062048 CACAGATCCCAGAGCTTCCAGGG - Intronic
1184230309 22:43155149-43155171 GAGAAGTCACAGAACTTTCTAGG - Intronic
949232805 3:1771578-1771600 GACAGGTCCCAGAACCTAACAGG - Intergenic
949282438 3:2362159-2362181 GGCAGGGCCCAGATCTATCAGGG + Intronic
949358600 3:3207688-3207710 GTCAGATCTTAGAACTTTCAGGG - Intergenic
953334107 3:42079331-42079353 GCCAGGTACCTGAGCTTTCAAGG - Intronic
954418028 3:50403616-50403638 GACAGGTCACAGAACTTGATGGG - Intronic
955532660 3:59890411-59890433 GGCAGGAACCAGAAGTTTCACGG - Intronic
955917348 3:63919929-63919951 GAAAGAGTCCAGAACTTTCATGG + Intronic
956013107 3:64852611-64852633 GTCAGGCACCAGACCTTTCAGGG + Intergenic
957946439 3:87069175-87069197 GACAGGTCTCTGAGTTTTCACGG - Intergenic
960146427 3:114208948-114208970 GAGAGGGGCCATAACTTTCATGG + Intergenic
964987603 3:162763866-162763888 GATAGGACTCAGAACTTTTAAGG + Intergenic
967595470 3:191322896-191322918 GGCAGGTCCAAGAAGTTCCAAGG - Intronic
968781839 4:2588274-2588296 AAGAGGCACCAGAACTTTCACGG - Intronic
969439285 4:7207964-7207986 GACAAGTCCCAGAAGTTCCCGGG - Intronic
969948876 4:10813262-10813284 CAGAGGTACCAGAGCTTTCAGGG - Intergenic
975391032 4:73817524-73817546 GACAGTTCCCACAACCTTCTAGG - Intergenic
975828178 4:78341356-78341378 GACACTTCCCAGAATCTTCAAGG - Intronic
979239879 4:118438747-118438769 GAGAGGTCCCAGGACTTTCCTGG - Intergenic
980458785 4:133077703-133077725 GACTGGACCCACAACTTTCTTGG + Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
986498085 5:8367249-8367271 GACAGGTCTCAAAACTTACAAGG - Intergenic
987961349 5:24813511-24813533 TACAGATCCCCTAACTTTCATGG - Intergenic
989500036 5:42155855-42155877 GACATGTCCATGAACTGTCATGG - Intergenic
993097442 5:83496028-83496050 TAGAAGTCCCAGAAATTTCAGGG + Intronic
995130286 5:108622934-108622956 GAGTGTTCCCAGAACTGTCATGG + Intergenic
999237482 5:150107753-150107775 GCCAGGTCCCCGGCCTTTCAAGG + Intronic
999768830 5:154759370-154759392 GACAGATCCCATACATTTCACGG - Intronic
1000044807 5:157513379-157513401 GCCAGGTGCCAGCACTTCCAAGG - Intronic
1002740130 5:181429330-181429352 GAGAGGTCCCAGGACTTTCCTGG - Intergenic
1003410101 6:5854565-5854587 GCCAGGTCCCAGAGCTTTTTGGG + Intergenic
1005056155 6:21730662-21730684 GACAGTTTGCAGAATTTTCAGGG + Intergenic
1005368746 6:25107548-25107570 GACAGGACGCAGAACATACAGGG + Intergenic
1007294727 6:40813381-40813403 CACAGGACTCAGAACTTACAAGG + Intergenic
1010274759 6:73956593-73956615 GCCAGGTCCCAGAACTATTTGGG + Intergenic
1011095285 6:83655125-83655147 GACTGGTCTCTGAATTTTCATGG - Intronic
1015332092 6:131991972-131991994 GAAATGTCCTAGAATTTTCAGGG - Intergenic
1015634694 6:135263856-135263878 GACAAGTCCCAGAGCCTTCCAGG + Intergenic
1016908975 6:149178345-149178367 GACAGGTTGGAGAACTTTCTAGG + Intergenic
1018344470 6:162886487-162886509 GACAGATCTCTGAACTTTCCAGG - Intronic
1019245244 6:170704930-170704952 GAGAGGTCCCAGGACTTCCCTGG - Intergenic
1019486081 7:1289842-1289864 GACAGGTCCCAGACATTGCCAGG - Intergenic
1019621339 7:1993907-1993929 GACAGGACCCAGGGCTTTCTGGG - Intronic
1020486381 7:8725847-8725869 GACAGTGCTCAGAACTTTCCAGG - Intronic
1022552515 7:31254703-31254725 GAGAGTTCCCAGAACTGTCACGG - Intergenic
1023823785 7:43995139-43995161 CACAGGTCCAAGAACCTGCAGGG - Intergenic
1023901646 7:44485898-44485920 GAGAGGTCCCAGCACCTTCATGG - Intronic
1024729720 7:52240705-52240727 AAGAGGTCCAAGAGCTTTCAGGG - Intergenic
1026506955 7:70993013-70993035 CCCAGATCCCAGAACTTCCATGG + Intergenic
1027969440 7:85059515-85059537 GACAGGACACTGAAATTTCAAGG - Intronic
1028276448 7:88863757-88863779 GCCAGGTGGCAGAACTTTCAAGG + Intronic
1029107840 7:98193106-98193128 AACAGGTCCCAGGACTCTCCTGG + Exonic
1029752052 7:102548552-102548574 CACAGGTCCAAGAACCTGCAGGG - Intronic
1029770004 7:102647646-102647668 CACAGGTCCAAGAACCTGCAGGG - Intronic
1032492200 7:132331973-132331995 GACAAGGCACTGAACTTTCATGG + Intronic
1032870902 7:135984054-135984076 GAAAACTCCCAGAACTCTCATGG - Intergenic
1033001202 7:137507179-137507201 GACAGGTCCCAGACATGGCATGG - Intronic
1038035602 8:23683367-23683389 GAGAGCACCCAGAACTCTCACGG - Intergenic
1038382546 8:27110137-27110159 GACTTGACCCTGAACTTTCAGGG - Intergenic
1038627908 8:29211689-29211711 GACAATTCCCAGAGCTTGCACGG + Intronic
1039299220 8:36191347-36191369 AACAGCTCACAGAACTCTCAAGG - Intergenic
1039365902 8:36927715-36927737 GACAGGAACCACAACATTCACGG + Intronic
1039826935 8:41182729-41182751 TAGAGCTCCCAGAACTTGCAGGG - Intergenic
1041072063 8:54135257-54135279 CGCAGATCCAAGAACTTTCAAGG - Exonic
1042842640 8:73139567-73139589 CACATGACCCAGAACTATCAGGG - Intergenic
1044892744 8:96854699-96854721 GACAAGTCCCAAAATCTTCAGGG + Intronic
1048996800 8:139799629-139799651 GACAGGGCACGGAATTTTCATGG - Intronic
1052741182 9:32394493-32394515 CCCAGGTCCCAGAAGTATCAAGG + Intronic
1054982189 9:71219849-71219871 GACAGTTTCCAGACCCTTCAAGG - Intronic
1055697913 9:78908078-78908100 GACAGATCCAAGAGCTTTTATGG + Intergenic
1058676426 9:107404081-107404103 GACACGTCCCCAAACTTTGAAGG + Intergenic
1060094767 9:120778365-120778387 GCCAGGACCCAGCACTTTCGGGG - Exonic
1062175619 9:135160552-135160574 GACAACTCCCAGAACTCACATGG + Intergenic
1203605439 Un_KI270748v1:54138-54160 GAGAGGTCCCAGGACTTTCCTGG - Intergenic
1186246925 X:7624792-7624814 GACAGGACAAAGAACTTTCTAGG - Intergenic
1188247436 X:27853374-27853396 GAAACGACCCAGAGCTTTCAGGG + Intergenic
1192861019 X:75070440-75070462 TACAGTTCCCAGAAAGTTCAGGG + Exonic
1196055186 X:111348090-111348112 TACAGGTCACTGAACCTTCATGG - Intronic
1196897806 X:120354867-120354889 AACAGGGCCCAGAAATTTGAAGG - Intergenic
1199859183 X:151784368-151784390 GACAGGAACCAGAACGTGCAAGG - Intergenic
1201380302 Y:13368634-13368656 GCCAGGTCCCAGCACTGTCGGGG - Intronic
1201513803 Y:14794487-14794509 TACAGCTCCAAGAATTTTCATGG - Intronic