ID: 1074567159

View in Genome Browser
Species Human (GRCh38)
Location 10:114590540-114590562
Sequence AGAACCTTTAGTGAGAAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074567159_1074567162 11 Left 1074567159 10:114590540-114590562 CCGTACTTCTCACTAAAGGTTCT 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1074567162 10:114590574-114590596 TGTGAATAAGGAGAAACCCAGGG No data
1074567159_1074567161 10 Left 1074567159 10:114590540-114590562 CCGTACTTCTCACTAAAGGTTCT 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG No data
1074567159_1074567160 -1 Left 1074567159 10:114590540-114590562 CCGTACTTCTCACTAAAGGTTCT 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1074567160 10:114590562-114590584 TGCTACTTGTAATGTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074567159 Original CRISPR AGAACCTTTAGTGAGAAGTA CGG (reversed) Intronic
902382146 1:16057802-16057824 AGAACCTTGAGTGAGATGGGAGG + Exonic
905087669 1:35396849-35396871 ATAACCTTTTCTGAGAAGGAAGG - Intronic
907428894 1:54399220-54399242 ACAACCCTAAGTGAGAAGTTAGG + Intronic
909192313 1:72569461-72569483 AGAACCTATAGTGTGACATATGG - Intergenic
909288398 1:73850598-73850620 AAAACATTTATTGAGAATTATGG - Intergenic
910442810 1:87270055-87270077 AGAACCTTTCATCAGAAGGAAGG - Intergenic
918149210 1:181783510-181783532 TGAGCCTTAAGTGAGAAGCAGGG + Intronic
918402387 1:184176475-184176497 TGGTCCTTTATTGAGAAGTATGG - Intergenic
921008565 1:211117671-211117693 AGCACCATTTGTGAGAAGAAAGG + Intronic
921566444 1:216727385-216727407 AGAACCTAAAATGAGAAGCAAGG + Intronic
923882707 1:238121120-238121142 AGAACTCTTAATGATAAGTAGGG + Intergenic
924286225 1:242490160-242490182 ATAACCCTTAGTGAGAACCATGG + Intronic
1063510374 10:6638788-6638810 AGAGCCTCTAGGGAGAACTAGGG - Intergenic
1063993647 10:11595067-11595089 AGAATCTGAAGTGGGAAGTAAGG + Intronic
1074567159 10:114590540-114590562 AGAACCTTTAGTGAGAAGTACGG - Intronic
1075623178 10:123942751-123942773 AGCAACTTTATAGAGAAGTAAGG - Intergenic
1079853442 11:25568289-25568311 AGAAAATTTATTGAGAAATATGG - Intergenic
1080730568 11:34947963-34947985 AGAACCTTTACTAGGTAGTATGG + Intronic
1083625841 11:64071594-64071616 AGAACCTGTAGTGGGAAGAGCGG - Intronic
1083803178 11:65058324-65058346 AGAACCTCAGGTGAGAAGTGGGG - Exonic
1085161044 11:74345681-74345703 AGAAGTTTTAATGAGAAGAAAGG - Intronic
1086109978 11:83189247-83189269 GGAACCTTTTGTGAGTAGGAAGG - Intergenic
1086685696 11:89730877-89730899 AGAGTCTTTAGTGAGCACTAAGG + Intergenic
1087364557 11:97202301-97202323 AGAAACTTTAGGGAGCACTATGG - Intergenic
1087976383 11:104553081-104553103 AGAATCTTGAATGATAAGTAGGG - Intergenic
1088372781 11:109109725-109109747 AGCAGCATTAGTGAGAAGTCTGG - Intergenic
1089112914 11:116071342-116071364 GGAACCTTCACTGAGAAGCATGG + Intergenic
1091817305 12:3448459-3448481 AAAAAATTTAGTGAGAAGAATGG + Intronic
1094361421 12:29635328-29635350 AGAACCTTTAGTGGGCTGAAAGG - Intronic
1095765964 12:45896198-45896220 AGAACCTTGTGTAAGAAGTGTGG + Intronic
1097059444 12:56271647-56271669 AGAACCTTTATTATGAGGTAAGG - Intergenic
1098482898 12:70986607-70986629 TGAACTTTTAGTGAGAGGTGTGG - Intergenic
1101055858 12:100912659-100912681 AGACACTTTATTGAGAAGTGTGG + Intronic
1101637782 12:106560391-106560413 AGAACCTTTATTCAGAAGAGTGG - Intronic
1104849541 12:131865258-131865280 AGACTGTTTAGTGAGAAGCAAGG + Intergenic
1104999835 12:132683077-132683099 ATAATCTTTCATGAGAAGTAAGG - Intronic
1105586713 13:21751670-21751692 AGAAAATTTAGTGGTAAGTAAGG - Intergenic
1106965333 13:35057851-35057873 ACAATCTTTAATTAGAAGTATGG - Intronic
1107274280 13:38659353-38659375 AGAACCTTAAGGGACCAGTAGGG - Intergenic
1107709596 13:43138722-43138744 AGAAGCTTTTGTGAGAAGGTAGG - Intergenic
1108418114 13:50221591-50221613 AGAACCTTTGGTGAAGAGGAGGG + Intronic
1109275885 13:60303903-60303925 AGAACCTTTATTGGGAAATTGGG + Intergenic
1109732004 13:66424437-66424459 AGGACCATTTGGGAGAAGTATGG + Intronic
1111780662 13:92719486-92719508 AGATCCTTTAATGGGAAGTGAGG - Intronic
1112382163 13:98902088-98902110 AGAACTTTTAGAAAGAAGAAAGG + Intronic
1112455572 13:99559185-99559207 AGCACCTTTAGTGAGGAGAGTGG + Intronic
1115127203 14:30010354-30010376 AAAAACTTTAGTGAGAAATTTGG + Intronic
1116820028 14:49619058-49619080 AGAACCTTCTGTAAGAAGTGTGG - Exonic
1119108813 14:71951358-71951380 AGAACCTGTAGAGAGAGGGAGGG + Intronic
1120420519 14:84280112-84280134 AGAACTTTTCGTGAGAGGAATGG - Intergenic
1120468493 14:84892664-84892686 TGAACCTTGAGTGAGAAGACTGG + Intergenic
1121663833 14:95656714-95656736 AGAATCCTCAGTGAGAAGTTGGG - Intergenic
1202831596 14_GL000009v2_random:40532-40554 AGAATCTTGAGTGAGAAGAAGGG + Intergenic
1123635130 15:22298388-22298410 AGAAACTAGAGTGAGAAGTAAGG - Intergenic
1125309134 15:38359499-38359521 AGAACCAATAGTGAAAAGTAAGG - Intergenic
1125451622 15:39813995-39814017 AGAACTTTTAGTGAGCATTTGGG - Intronic
1128194274 15:65736870-65736892 AAAAACTTTAGTGAGCAGAATGG - Intronic
1128470650 15:67949366-67949388 AAAACATTTAGTGAGAAGACTGG - Intergenic
1130071752 15:80652624-80652646 AGAACCATTTATTAGAAGTAAGG - Intergenic
1131399168 15:92110831-92110853 AAAACCCTGAGTGGGAAGTAGGG - Intronic
1136007803 16:27343002-27343024 AGACCCTTGATTGAGGAGTACGG + Intronic
1143341447 17:6214394-6214416 AGTACCTGTGGTGAGAAGTAGGG - Intergenic
1143968184 17:10772184-10772206 AAACCCTTTAGTGAGGATTAGGG + Intergenic
1147589777 17:41674860-41674882 AGAACCTCTAGAGAGCAGGAGGG - Intergenic
1149928664 17:60727436-60727458 AGAACCTTCTGTAAGAAGTGTGG - Intronic
1151891193 17:76951402-76951424 AGAACCCTTGGTGGGAAGGAAGG - Intergenic
1152425065 17:80214242-80214264 GGAACCTTCTGTGAGAAGTTTGG - Exonic
1152493079 17:80650905-80650927 AATACTTTTAGAGAGAAGTAGGG + Intronic
1153302613 18:3604521-3604543 GGAACCTTAAGTGAAAAATAAGG - Intronic
1157225499 18:45859455-45859477 AGAAGCAGTAGTGAGAAGGAGGG - Intronic
1164835896 19:31354869-31354891 ACAATCTTTGGAGAGAAGTAGGG + Intergenic
1165942356 19:39421235-39421257 AGAAGCATTAGTGAGATGTAAGG - Intronic
1168471483 19:56643785-56643807 AGTATCTGTAGCGAGAAGTATGG + Intronic
1202641102 1_KI270706v1_random:87223-87245 AGAATCTTGAGTGAGAAGAAGGG - Intergenic
926476858 2:13333390-13333412 AAAAACTTTAATGAGATGTAAGG - Intergenic
926479475 2:13372701-13372723 AGAAACTAGAGTGAGAAGTAAGG - Intergenic
927263272 2:21116560-21116582 AGAAGCTTTGGTTAGAAGTGAGG + Intergenic
928359442 2:30651184-30651206 CAAAAATTTAGTGAGAAGTATGG + Intergenic
929306041 2:40362951-40362973 AGGACATTTAGTCAGAACTAAGG - Intronic
931233772 2:60396194-60396216 AGAACCTTTAGGAGGAAGTGAGG - Intergenic
931904140 2:66824138-66824160 AGACTCTTTACTTAGAAGTAGGG + Intergenic
932198597 2:69805956-69805978 AAAACATTTAGTGAGAAGATTGG + Intronic
932724667 2:74169115-74169137 ACAAATTTTAGTGAGAAGTATGG - Intronic
942618953 2:177826831-177826853 AGAACCTTTCCTGAGAAGAAGGG - Intronic
943471436 2:188299106-188299128 AGAAGCTTTGGTGGGAAGGACGG + Intronic
944342052 2:198612755-198612777 AGACTTTTTAATGAGAAGTATGG - Intergenic
946814791 2:223565764-223565786 AAAACAATTAGTGAGAAGTTGGG - Intergenic
1170287892 20:14731889-14731911 AAAAAATTTAGTGAGAAGAATGG - Intronic
1171888210 20:30677436-30677458 AGAATCTTGAGTGGGAAGAAGGG - Intergenic
1175062731 20:56258371-56258393 GGGACCTTGAGTGAGAAGAATGG + Intergenic
1176610784 21:8885364-8885386 AGAATCTTGAGTGAGAAGAAGGG + Intergenic
1177160122 21:17538428-17538450 AGGACCTTGAGGGAGAATTAAGG + Intronic
1178215366 21:30591553-30591575 AGAACATTTAGTCAGAATTTCGG + Intergenic
1178620693 21:34171824-34171846 AGAACCCTTAGCCAAAAGTAAGG - Intergenic
1180360856 22:11894649-11894671 AGGATCTTGAGTGAGAAGAAGGG + Intergenic
1182765508 22:32755126-32755148 CGAACATTTACTGAGAACTATGG + Intronic
1183859455 22:40658984-40659006 AAAACCTTTACTGAGAAATTGGG + Intergenic
1184829940 22:46978423-46978445 AAAATGTTTAGTGAGAAGAAAGG + Intronic
1185185824 22:49399194-49399216 AAAACATTTAGTGATAAGTGAGG + Intergenic
952171467 3:30811855-30811877 AGAATTTTCAGTGTGAAGTAAGG + Intronic
957849178 3:85783357-85783379 AGAAGTGTTGGTGAGAAGTAAGG - Intronic
957866816 3:86036255-86036277 AGAACCTAGGATGAGAAGTAAGG - Intronic
958120985 3:89287826-89287848 AGAATCTTGAGTGGGAAGAAGGG - Intronic
959898697 3:111635288-111635310 ATAACATGTAGTGGGAAGTATGG - Intronic
960390622 3:117073438-117073460 AGAAACTGAAGTGAGAAATAGGG + Intronic
960838286 3:121929970-121929992 AGAACTTTTAGTGAAAAGTCTGG + Intronic
967813524 3:193780456-193780478 AGAGCCCTTAGTGAGAAGACTGG - Intergenic
1202737463 3_GL000221v1_random:20168-20190 AGAATCTTGAGTGAGAAGAAGGG + Intergenic
970056284 4:11976861-11976883 AGAAACTTAAGTGTAAAGTAAGG + Intergenic
970116378 4:12701002-12701024 AGAACATTTACAGAGAAGGAAGG + Intergenic
970700336 4:18729429-18729451 GGAAACTCTAGTGAAAAGTATGG + Intergenic
971278896 4:25224820-25224842 AGAACCTATAGGGTGAAGAATGG - Intronic
971500309 4:27311760-27311782 AGAAACATTAGAGAGAAGTCGGG + Intergenic
973384615 4:49497754-49497776 AGAATCTTGAGTGAGAAGAAGGG - Intergenic
976952197 4:90847418-90847440 AGAACATGTAGTAAGAAGCAAGG - Intronic
977807043 4:101313088-101313110 AGGATCTTTAGTAATAAGTAAGG - Intronic
978879823 4:113688305-113688327 AGAAGCTTTAGTGGGAGGGAAGG + Intronic
980002835 4:127510975-127510997 ATAAAATTTAGTGAGAAGTGTGG - Intergenic
981341768 4:143629309-143629331 AGAACCTGCAGTGCGAAGGAGGG - Intronic
982894212 4:160896406-160896428 AGAACTTTTAGTATGAAATATGG + Intergenic
982980903 4:162133845-162133867 AGAATCCTTACTGAGAAGAAAGG - Intronic
1202768468 4_GL000008v2_random:173076-173098 AGAATCTTGAGTGAGAAGAAGGG - Intergenic
986546390 5:8902746-8902768 ACAACATTTAAGGAGAAGTAGGG - Intergenic
987448315 5:18049574-18049596 AGAACCTTCTGTAAGAAGTGTGG + Intergenic
990193160 5:53285113-53285135 AGATACTTTACTGAGAAGCAAGG - Intergenic
992398852 5:76393104-76393126 AGAACTTTGAGTGAGAAGAAGGG + Intergenic
994767386 5:103935992-103936014 TGAGACTTGAGTGAGAAGTAGGG + Intergenic
996899005 5:128521914-128521936 AAAATCTTTAGTGAGAAGGGAGG - Intronic
997977127 5:138447017-138447039 AGGACCTCAAGTGAGAAGCAGGG + Intergenic
1000200129 5:159001147-159001169 AAAACATTTAGTTAGAAGAATGG - Intronic
1005082405 6:21969967-21969989 AAAACATTTAGTGAGAAGAGTGG - Intergenic
1006823432 6:36916553-36916575 AGAACCTGTTGTGGGGAGTAAGG + Exonic
1008364987 6:50667754-50667776 AGAAAATTAAGTGTGAAGTAAGG + Intergenic
1010844053 6:80682888-80682910 AGAAACTTTTCTGTGAAGTATGG + Intergenic
1011161824 6:84399716-84399738 AGATCCTTAAGTGAGATGTTAGG + Intergenic
1012930394 6:105310422-105310444 AGCACTTTCAGTGAGTAGTAGGG - Intronic
1021067307 7:16192298-16192320 AGAACCCTGAGTGATATGTAAGG + Intronic
1022827277 7:34028268-34028290 AAAAAAATTAGTGAGAAGTATGG - Intronic
1026377511 7:69766815-69766837 ATAACCTAAAGTGAGAAGCATGG - Intronic
1027473380 7:78599910-78599932 AGAACCTTTCGTGTGAACTTTGG + Intronic
1032202998 7:129836577-129836599 ACAACCTTAAGAGAGAACTATGG + Intronic
1032751227 7:134843756-134843778 AGAATCTAAAGGGAGAAGTAAGG - Intronic
1033929128 7:146502398-146502420 AGAACCATTAGTGAGATTTCTGG + Intronic
1035794909 8:2346676-2346698 ACCACCTTTAGTGAGTAGCAAGG - Intergenic
1038057197 8:23871638-23871660 AAAACCTTTACTTAAAAGTAAGG - Intergenic
1040679149 8:49788047-49788069 AGAAGTTTTATTGAGATGTATGG - Intergenic
1040679487 8:49791354-49791376 AGAAGTTTTATTGAGATGTATGG - Intergenic
1040804593 8:51379908-51379930 AGAAACATTAGTGAGAAGTGAGG - Intronic
1049322457 8:142003936-142003958 AGAACATTTACTAAGAGGTAAGG + Intergenic
1050124910 9:2346896-2346918 AGAAGCTTAAGAGAAAAGTATGG - Intergenic
1050587000 9:7123398-7123420 AGAACCTGTAGGGATAAATAGGG + Intergenic
1050730111 9:8699731-8699753 AGAATCTTTATTGAAAAGAAAGG + Intronic
1051848143 9:21476111-21476133 AGAACCATTAGTTAGAAGAGAGG + Intergenic
1059583042 9:115573186-115573208 AGAACCTAGAGTTAGCAGTAAGG - Intergenic
1203693361 Un_GL000214v1:66936-66958 AGAATCTTGAGTGAGAAGAAGGG - Intergenic
1203706190 Un_KI270742v1:50612-50634 AGAATCTTGAGTGAGAAGAAGGG + Intergenic
1203557810 Un_KI270744v1:15302-15324 AGAATATTGAGTGAGAAGAAGGG - Intergenic
1203642912 Un_KI270751v1:37127-37149 AGAATCTTGAGTGAGAAGAAGGG + Intergenic
1190509487 X:51161600-51161622 AGAACCCTTATTGAGAATTGAGG + Intergenic
1197182535 X:123551864-123551886 AGAACCTTCACTGACAAATATGG + Intergenic
1198063284 X:133069402-133069424 AGAAGCTTAAGAGAGAAGAATGG + Intronic
1199828484 X:151524763-151524785 AGAAGCTTTTGTGAAAAGGAGGG - Intergenic