ID: 1074567161

View in Genome Browser
Species Human (GRCh38)
Location 10:114590573-114590595
Sequence ATGTGAATAAGGAGAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074567159_1074567161 10 Left 1074567159 10:114590540-114590562 CCGTACTTCTCACTAAAGGTTCT 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074567161 Original CRISPR ATGTGAATAAGGAGAAACCC AGG Intronic
No off target data available for this crispr