ID: 1074573579

View in Genome Browser
Species Human (GRCh38)
Location 10:114647537-114647559
Sequence ATGACCTGGATCATTTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074573579_1074573582 -9 Left 1074573579 10:114647537-114647559 CCTTACAAAATGATCCAGGTCAT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1074573582 10:114647551-114647573 CCAGGTCATGATGGACAGAAAGG No data
1074573579_1074573583 -8 Left 1074573579 10:114647537-114647559 CCTTACAAAATGATCCAGGTCAT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1074573583 10:114647552-114647574 CAGGTCATGATGGACAGAAAGGG No data
1074573579_1074573585 15 Left 1074573579 10:114647537-114647559 CCTTACAAAATGATCCAGGTCAT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1074573585 10:114647575-114647597 AGCTGGCTGAGCGCTAGCTGTGG No data
1074573579_1074573584 -2 Left 1074573579 10:114647537-114647559 CCTTACAAAATGATCCAGGTCAT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1074573584 10:114647558-114647580 ATGATGGACAGAAAGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074573579 Original CRISPR ATGACCTGGATCATTTTGTA AGG (reversed) Intronic
901651380 1:10745049-10745071 ATGACCTGGATATTTTTGGCAGG + Intronic
904732328 1:32603798-32603820 GTGAACTTGATCATTTTGTGGGG - Exonic
906385110 1:45361329-45361351 ATGCCTTGGGTCATTTTATAGGG - Intronic
907158574 1:52355632-52355654 ATGACCTGGATGCTTTTGTGCGG - Exonic
907922776 1:58928977-58928999 ATGACCTGGCTCATCTTGACTGG + Intergenic
909339682 1:74517800-74517822 ATCACCTGGAAGATTTTTTAAGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
917720118 1:177779383-177779405 ATGGCCTGGCTCCTTTTGTGAGG - Intergenic
918857798 1:189781147-189781169 ATCACCTGGGTAATTTTTTATGG + Intergenic
920404587 1:205699629-205699651 ATGACTTGGATGAATCTGTAGGG + Intergenic
921255745 1:213337791-213337813 ATGACTTGGCCCATTTTGTGTGG - Intergenic
1074573579 10:114647537-114647559 ATGACCTGGATCATTTTGTAAGG - Intronic
1079539952 11:21561258-21561280 ATGAACTGGATGATTTCTTAAGG - Intronic
1080095693 11:28403650-28403672 ATGACATGGTTCATTGTGTGTGG - Intergenic
1080900580 11:36486519-36486541 GTGACCTGTATAATTTTATATGG + Intergenic
1082137106 11:48561901-48561923 ATGAACTTTATCATTTTTTATGG + Intergenic
1082675085 11:56088647-56088669 ATGACCTGGAACAGTTTGTGTGG + Intergenic
1086073319 11:82822680-82822702 TTCAACTGCATCATTTTGTAAGG - Intergenic
1089236618 11:117032987-117033009 ATTACCTGGACCTTTTTGTAAGG - Intronic
1095567522 12:43643001-43643023 TTGACCTGTGTCTTTTTGTAAGG - Intergenic
1096595694 12:52693649-52693671 CTGACCTGGATCTTTTTGGATGG - Intronic
1106859856 13:33894142-33894164 TTCACCTGGCTCATTGTGTAGGG - Intronic
1107688952 13:42932781-42932803 TTTACTTGGATCATTTGGTAAGG - Intronic
1110406704 13:75159132-75159154 ATGACCTTGTTCTTTTTTTATGG - Intergenic
1110821079 13:79917245-79917267 AGGAACTGTATCATTTTCTATGG + Intergenic
1111252997 13:85629151-85629173 ATGACATGCATCTTTTTGGATGG - Intergenic
1116035548 14:39622820-39622842 ATGACCTTGTTCCTTTTTTATGG + Intergenic
1118282881 14:64445123-64445145 TTGAGCTGGATAATGTTGTAGGG - Intronic
1118468171 14:66050384-66050406 ATGACCTGGAAGACTTCGTATGG + Intergenic
1120768122 14:88350262-88350284 TTGACCTAGATGATTTTGAAAGG + Intergenic
1123857791 15:24431694-24431716 ATGACCTTGACCCTTTTGAAAGG + Intergenic
1125600649 15:40913828-40913850 AGGCCCTGGATCCTCTTGTAGGG - Intergenic
1128678100 15:69626562-69626584 CTGACCAGGGTCATTTTGCAAGG + Intergenic
1132797786 16:1733808-1733830 AGCCCCTCGATCATTTTGTAAGG + Intronic
1138916262 16:61468451-61468473 ATGACCTTTATTATTTTGCATGG - Intergenic
1140057422 16:71537401-71537423 ATGACCTGCATCACATAGTAGGG - Exonic
1147112980 17:38277518-38277540 ATGGCCTGGATCATTCTGGGGGG - Intergenic
1149970163 17:61209960-61209982 CTTCCCTGGATCATTTTGTAGGG + Intronic
1156923454 18:42551244-42551266 TTGGCTTTGATCATTTTGTAAGG - Intergenic
928777933 2:34789473-34789495 ATGTCCCAGATCATTTTGTCAGG - Intergenic
929626473 2:43413839-43413861 ATGGCCTGCATTATTTTGAATGG - Intronic
931488334 2:62716375-62716397 AAGAGCTGGATAATTTTTTAAGG + Intronic
931806642 2:65813587-65813609 CTCACCTGGTTCATTTAGTATGG - Intergenic
934551939 2:95268048-95268070 ATGCCCAGGATGCTTTTGTAAGG - Intergenic
936583689 2:113731158-113731180 ATGACCTTGACACTTTTGTAGGG - Intronic
939235916 2:139492612-139492634 CTGACCTGGCACATTTTGGATGG + Intergenic
940565517 2:155355824-155355846 ATCACCTTGATTATTTTGTACGG + Intergenic
941822038 2:169853322-169853344 ATGAGCAGGATCTTTTTGTCAGG + Intronic
942316793 2:174704306-174704328 ATGACGTGGAGCACTTTGTATGG + Intergenic
942605186 2:177683226-177683248 TTGACCTGCATCATCTTGAAAGG - Intronic
942755797 2:179339802-179339824 ATGAAATGGATCATATTCTATGG + Intergenic
942876799 2:180809956-180809978 ATAACCAGGATCATTTGGTATGG - Intergenic
943673073 2:190685861-190685883 TTGACATGTATTATTTTGTAGGG + Intronic
948325780 2:237119623-237119645 ATGTCCAGGATAATTTTGTTAGG - Intergenic
1170796286 20:19549880-19549902 ATGACCTGCATCATATTCTTTGG - Intronic
1174673443 20:52330529-52330551 ATGGCCTGGATGATTTTGATTGG + Intergenic
1174884547 20:54318100-54318122 ATGAAATGGTACATTTTGTAGGG - Intergenic
1177413691 21:20766968-20766990 ATGAGCTGTATAATTTTGAAAGG + Intergenic
949722576 3:7007721-7007743 ATGAACTTGAACATTTTGTGGGG - Intronic
951839329 3:27016831-27016853 ATGAACTGTATCATTTAGAAGGG - Intergenic
952326369 3:32323927-32323949 CTGGCCTGCATCATTTTGCAGGG - Intronic
953144007 3:40256794-40256816 ATGACCTGGAATATTTTATATGG - Intronic
962028989 3:131579307-131579329 ATGAACTGTAACATTTTGAAAGG - Intronic
963429718 3:145183894-145183916 ACGATCTGAATCACTTTGTAAGG - Intergenic
964113816 3:153114461-153114483 ATGAACTCGATCATTTTTTATGG - Intergenic
966565978 3:181382069-181382091 ATGACCTGTGTCACTTTGGATGG + Intergenic
969282270 4:6178758-6178780 ATGACCTAGAGAATTTGGTAGGG - Intronic
970584338 4:17500722-17500744 ATGACCTGTATTAGTTTGTTTGG - Intronic
971834530 4:31746546-31746568 ATCAGATGGTTCATTTTGTAAGG - Intergenic
979286903 4:118936597-118936619 ACAGCCTGGAGCATTTTGTATGG + Intronic
980485970 4:133458230-133458252 ATGAGCTGGATTCTTTTATAAGG + Intergenic
981679785 4:147383722-147383744 ATGACCTTGTTCTTTTTTTATGG - Intergenic
983204236 4:164896404-164896426 ATGTCCTTTATTATTTTGTATGG + Exonic
985140615 4:186836799-186836821 ATGACTTGAATCTTTTTGGAAGG - Intergenic
985942743 5:3151508-3151530 ATGATCTGGCTCTTTTTTTATGG + Intergenic
988789971 5:34598736-34598758 ATGACCTAGATAAATTTCTACGG - Intergenic
990248316 5:53886179-53886201 AAGACCTTGATCATTTTCTCTGG - Exonic
990270517 5:54132890-54132912 ATGACCTGTATCTTGTGGTATGG + Intronic
990983287 5:61620275-61620297 GTGTCCTGCATAATTTTGTAAGG + Intergenic
991674206 5:69075568-69075590 CTGACCTGGTGCATTATGTATGG + Intergenic
992494790 5:77281760-77281782 AGGACCTGGATCTCTTTGGAGGG + Intronic
994619789 5:102149575-102149597 ATGACCTCATTCATTTTTTATGG - Intergenic
995105872 5:108377802-108377824 ATGGCCTAGATCATTTTTTAAGG + Intronic
995245022 5:109925300-109925322 TTGACCTGGATCATTGACTAAGG + Intergenic
996275075 5:121655783-121655805 ATGACAGGGATCATTTTTGATGG - Intergenic
996359250 5:122627438-122627460 AAGAAATGGATCATTTTGAAAGG - Intergenic
1001090014 5:168732415-168732437 ATGACATTGGTCATTTGGTAGGG - Intronic
1002204998 5:177556343-177556365 ATATCCTGGATGATTTGGTAAGG + Intergenic
1002909125 6:1475334-1475356 ATGACTGGGATCATATAGTATGG - Intergenic
1004499228 6:16194625-16194647 ATGACTGGGATCGTTTTTTAAGG + Intergenic
1005206423 6:23410542-23410564 CTGCCCTGAATCTTTTTGTAAGG - Intergenic
1006262453 6:32886594-32886616 ACCACCTGTATCATTTTGCAGGG + Intergenic
1006624800 6:35389819-35389841 AGGAACTGTATCATTTTGAAAGG + Intronic
1007610068 6:43143461-43143483 ATGGTCTGGATCATCTTGTAGGG - Exonic
1007939237 6:45761885-45761907 ATGACCAGTATCTTTTTGTTTGG - Intergenic
1010523538 6:76872404-76872426 ATGATCTGGTTCTTTTTTTATGG + Intergenic
1013910314 6:115268413-115268435 ATGACCTGGATCAATCTCCAAGG + Intergenic
1014084576 6:117328518-117328540 ATGAACAGGAACATTTTTTAAGG + Intronic
1015229026 6:130892497-130892519 ATGAGCTGGCTCATGTTGTCTGG + Intronic
1017320199 6:153082935-153082957 ATCACCTGGAGCATTTAATATGG - Intronic
1021145608 7:17084993-17085015 ATGACCTGGCTAAATTTTTATGG + Intergenic
1021217540 7:17935500-17935522 ATCACCTTGATTATTTTCTATGG - Intronic
1030388042 7:108890403-108890425 ATGACTTGGTTCTTTTTTTATGG - Intergenic
1031759298 7:125691241-125691263 ATTACCTGTATGATTTTATATGG - Intergenic
1031878280 7:127166470-127166492 AAAACCTGGCTGATTTTGTATGG - Intronic
1033043753 7:137941902-137941924 ATGACCTTCATCATTTTTTATGG - Intronic
1036521669 8:9497644-9497666 ATCACCCAGATCATTTTGTTTGG + Intergenic
1037417214 8:18664973-18664995 ATGACCAGTAACATTTTGAAAGG - Intronic
1039116200 8:34093981-34094003 ATAAACTGGAACATCTTGTAAGG - Intergenic
1044130406 8:88516561-88516583 ATGACTTTGAGCATTTTCTATGG - Intergenic
1044502929 8:92982238-92982260 ATCACCTGGATATTTTTCTATGG + Intronic
1049911329 9:271334-271356 ATGCCCTGGATCTTTTTCTTGGG + Intronic
1050836209 9:10082098-10082120 ATGAAGAGGTTCATTTTGTATGG - Intronic
1051530608 9:18098888-18098910 TTGACCTGGATCTTTGTTTAAGG - Intergenic
1056859743 9:90169757-90169779 ATGACCTGGATAATCTAGAAAGG - Intergenic
1057755829 9:97834164-97834186 ATGCCCTGGATCAATTAGAATGG - Intergenic
1059256431 9:112935454-112935476 ATGAGCTGGATGATTCTGTTTGG + Intergenic
1060524333 9:124312067-124312089 ATGACCTGGGGCATTTTGCATGG + Intronic
1061722365 9:132560529-132560551 ATGACCTGGAGCCATTGGTATGG + Intronic
1187952843 X:24487657-24487679 ATGAGCTGGATCATTCTGTTGGG + Intronic
1187999809 X:24969994-24970016 ATGACCTCGTTCCTTTTTTATGG + Intronic
1188359876 X:29240122-29240144 AGGACATGGATCTTTTTGTTGGG + Intronic
1188774774 X:34201194-34201216 ATGACTTGATTCATTTTGGAAGG + Intergenic
1189045878 X:37590327-37590349 ATGACCTGGAACATTTGCTGAGG - Intronic
1192823999 X:74675620-74675642 AAGATTTGGTTCATTTTGTATGG + Intergenic
1192831873 X:74758734-74758756 ATGACCTCGTTCTTTTTTTATGG + Intronic
1195558524 X:106255641-106255663 AGCACATGGATCATTTTCTAAGG - Intergenic
1200912046 Y:8539385-8539407 GTGACCAGGAACATTTTGAATGG + Intergenic