ID: 1074578786

View in Genome Browser
Species Human (GRCh38)
Location 10:114696432-114696454
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074578786_1074578789 -7 Left 1074578786 10:114696432-114696454 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1074578789 10:114696448-114696470 TATAAGGACACCATTTGATATGG No data
1074578786_1074578790 -2 Left 1074578786 10:114696432-114696454 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1074578790 10:114696453-114696475 GGACACCATTTGATATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074578786 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intergenic
Too many off-targets to display for this crispr