ID: 1074581702

View in Genome Browser
Species Human (GRCh38)
Location 10:114725226-114725248
Sequence GTGGATATACCAGCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074581699_1074581702 -2 Left 1074581699 10:114725205-114725227 CCACAACTAGCAATTTACCTGGT No data
Right 1074581702 10:114725226-114725248 GTGGATATACCAGCAAAAACAGG No data
1074581697_1074581702 22 Left 1074581697 10:114725181-114725203 CCATAATTTGTGAACTAACAAAT No data
Right 1074581702 10:114725226-114725248 GTGGATATACCAGCAAAAACAGG No data
1074581696_1074581702 23 Left 1074581696 10:114725180-114725202 CCCATAATTTGTGAACTAACAAA No data
Right 1074581702 10:114725226-114725248 GTGGATATACCAGCAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074581702 Original CRISPR GTGGATATACCAGCAAAAAC AGG Intergenic
No off target data available for this crispr