ID: 1074584509

View in Genome Browser
Species Human (GRCh38)
Location 10:114754270-114754292
Sequence AGATTTATGCAAAGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074584509_1074584514 11 Left 1074584509 10:114754270-114754292 CCCTTCACCCTTTGCATAAATCT No data
Right 1074584514 10:114754304-114754326 CAAACCGTGAATTTCTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074584509 Original CRISPR AGATTTATGCAAAGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr