ID: 1074586013

View in Genome Browser
Species Human (GRCh38)
Location 10:114768257-114768279
Sequence CCGCGCCCGGCGGGTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074586013_1074586020 5 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586020 10:114768285-114768307 CTGACACCCGCGGCCGCGCTGGG No data
1074586013_1074586023 10 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586023 10:114768290-114768312 ACCCGCGGCCGCGCTGGGCGGGG No data
1074586013_1074586021 8 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586021 10:114768288-114768310 ACACCCGCGGCCGCGCTGGGCGG No data
1074586013_1074586022 9 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586022 10:114768289-114768311 CACCCGCGGCCGCGCTGGGCGGG No data
1074586013_1074586019 4 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586019 10:114768284-114768306 GCTGACACCCGCGGCCGCGCTGG No data
1074586013_1074586018 -5 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586018 10:114768275-114768297 CGCGGCAGCGCTGACACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074586013 Original CRISPR CCGCGCCCGGCGGGTCCCTG CGG (reversed) Intergenic
No off target data available for this crispr