ID: 1074586014

View in Genome Browser
Species Human (GRCh38)
Location 10:114768257-114768279
Sequence CCGCAGGGACCCGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074586003_1074586014 12 Left 1074586003 10:114768222-114768244 CCGCGCAGCAAGGCCGACGGGCG No data
Right 1074586014 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
1074585996_1074586014 26 Left 1074585996 10:114768208-114768230 CCTGGCCGCCCGCTCCGCGCAGC No data
Right 1074586014 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
1074586000_1074586014 17 Left 1074586000 10:114768217-114768239 CCGCTCCGCGCAGCAAGGCCGAC No data
Right 1074586014 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
1074586008_1074586014 -1 Left 1074586008 10:114768235-114768257 CCGACGGGCGGGGACGCAGCGGC No data
Right 1074586014 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
1074585999_1074586014 18 Left 1074585999 10:114768216-114768238 CCCGCTCCGCGCAGCAAGGCCGA No data
Right 1074586014 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
1074585998_1074586014 21 Left 1074585998 10:114768213-114768235 CCGCCCGCTCCGCGCAGCAAGGC No data
Right 1074586014 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074586014 Original CRISPR CCGCAGGGACCCGCCGGGCG CGG Intergenic