ID: 1074586018 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:114768275-114768297 |
Sequence | CGCGGCAGCGCTGACACCCG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074586013_1074586018 | -5 | Left | 1074586013 | 10:114768257-114768279 | CCGCAGGGACCCGCCGGGCGCGG | No data | ||
Right | 1074586018 | 10:114768275-114768297 | CGCGGCAGCGCTGACACCCGCGG | No data | ||||
1074586008_1074586018 | 17 | Left | 1074586008 | 10:114768235-114768257 | CCGACGGGCGGGGACGCAGCGGC | No data | ||
Right | 1074586018 | 10:114768275-114768297 | CGCGGCAGCGCTGACACCCGCGG | No data | ||||
1074586003_1074586018 | 30 | Left | 1074586003 | 10:114768222-114768244 | CCGCGCAGCAAGGCCGACGGGCG | No data | ||
Right | 1074586018 | 10:114768275-114768297 | CGCGGCAGCGCTGACACCCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074586018 | Original CRISPR | CGCGGCAGCGCTGACACCCG CGG | Intergenic | ||