ID: 1074586018

View in Genome Browser
Species Human (GRCh38)
Location 10:114768275-114768297
Sequence CGCGGCAGCGCTGACACCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074586003_1074586018 30 Left 1074586003 10:114768222-114768244 CCGCGCAGCAAGGCCGACGGGCG No data
Right 1074586018 10:114768275-114768297 CGCGGCAGCGCTGACACCCGCGG No data
1074586013_1074586018 -5 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586018 10:114768275-114768297 CGCGGCAGCGCTGACACCCGCGG No data
1074586008_1074586018 17 Left 1074586008 10:114768235-114768257 CCGACGGGCGGGGACGCAGCGGC No data
Right 1074586018 10:114768275-114768297 CGCGGCAGCGCTGACACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074586018 Original CRISPR CGCGGCAGCGCTGACACCCG CGG Intergenic