ID: 1074586020

View in Genome Browser
Species Human (GRCh38)
Location 10:114768285-114768307
Sequence CTGACACCCGCGGCCGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074586017_1074586020 -8 Left 1074586017 10:114768270-114768292 CCGGGCGCGGCAGCGCTGACACC No data
Right 1074586020 10:114768285-114768307 CTGACACCCGCGGCCGCGCTGGG No data
1074586015_1074586020 -4 Left 1074586015 10:114768266-114768288 CCCGCCGGGCGCGGCAGCGCTGA No data
Right 1074586020 10:114768285-114768307 CTGACACCCGCGGCCGCGCTGGG No data
1074586008_1074586020 27 Left 1074586008 10:114768235-114768257 CCGACGGGCGGGGACGCAGCGGC No data
Right 1074586020 10:114768285-114768307 CTGACACCCGCGGCCGCGCTGGG No data
1074586016_1074586020 -5 Left 1074586016 10:114768267-114768289 CCGCCGGGCGCGGCAGCGCTGAC No data
Right 1074586020 10:114768285-114768307 CTGACACCCGCGGCCGCGCTGGG No data
1074586013_1074586020 5 Left 1074586013 10:114768257-114768279 CCGCAGGGACCCGCCGGGCGCGG No data
Right 1074586020 10:114768285-114768307 CTGACACCCGCGGCCGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074586020 Original CRISPR CTGACACCCGCGGCCGCGCT GGG Intergenic
No off target data available for this crispr