ID: 1074599455

View in Genome Browser
Species Human (GRCh38)
Location 10:114899073-114899095
Sequence AGTGAAGCCCAGCCCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074599453_1074599455 3 Left 1074599453 10:114899047-114899069 CCTAGAGGATGGACAACCACATG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG No data
1074599452_1074599455 6 Left 1074599452 10:114899044-114899066 CCTCCTAGAGGATGGACAACCAC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG No data
1074599449_1074599455 29 Left 1074599449 10:114899021-114899043 CCATGTGAAGAGGAATAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074599455 Original CRISPR AGTGAAGCCCAGCCCTAAGC TGG Intronic
No off target data available for this crispr