ID: 1074603604

View in Genome Browser
Species Human (GRCh38)
Location 10:114938727-114938749
Sequence GAGAACTACAACTGCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074603604_1074603610 26 Left 1074603604 10:114938727-114938749 CCTACTTGGCAGTTGTAGTTCTC 0: 1
1: 0
2: 0
3: 17
4: 117
Right 1074603610 10:114938776-114938798 ACACAATAAAACCCTGCCCTTGG No data
1074603604_1074603611 27 Left 1074603604 10:114938727-114938749 CCTACTTGGCAGTTGTAGTTCTC 0: 1
1: 0
2: 0
3: 17
4: 117
Right 1074603611 10:114938777-114938799 CACAATAAAACCCTGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074603604 Original CRISPR GAGAACTACAACTGCCAAGT AGG (reversed) Intronic
900782044 1:4624696-4624718 GAGAACTACAAGTGAGAAATTGG + Intergenic
905654619 1:39678076-39678098 GAGAACTGGAACTGGCAACTGGG - Intergenic
907360763 1:53912658-53912680 GAGAACTACAAGGGCAAAGGTGG + Intergenic
907615366 1:55919014-55919036 GAGAAATAGAACTGCCCACTTGG - Intergenic
909402850 1:75253537-75253559 GAGATCTACAAGTGCTAACTTGG + Intronic
912321986 1:108721939-108721961 GAGAACTAAAAGGGCCACGTGGG - Intronic
912905307 1:113699354-113699376 GAGGACTACAACGGCTATGTTGG - Intronic
915877690 1:159629493-159629515 GAGAACTACAACTGAAAATATGG + Intergenic
917599039 1:176557076-176557098 GAGACCTTTAACTCCCAAGTAGG + Exonic
918060693 1:181058836-181058858 GAGAAACACAATTGCTAAGTGGG + Exonic
918379264 1:183938114-183938136 GAGAACTCCAACTGCCATGATGG + Exonic
919028533 1:192208404-192208426 GAGAAATACTACAGCCAAGGAGG + Intergenic
920881113 1:209881265-209881287 GACGGCTACAATTGCCAAGTTGG - Intergenic
920899779 1:210096711-210096733 AAAACCTACAACTGCCTAGTAGG - Intronic
922231597 1:223691980-223692002 GAAAATTACAACTACCAACTAGG - Intergenic
923007415 1:230062334-230062356 AAAAACTACAAATGACAAGTTGG - Intronic
924849269 1:247808478-247808500 GAGAACTCCACCTGCCACATAGG + Intergenic
1063407162 10:5807614-5807636 GAGAACGTCAAGTGCCAGGTGGG - Intronic
1064273238 10:13883580-13883602 GAGATCTGCAACTTCCAACTGGG - Intronic
1073644273 10:105283504-105283526 GAGAACCACAACTGCACCGTAGG + Intergenic
1073715819 10:106106208-106106230 GAGAAATACCACTGCAAAGAAGG + Intergenic
1074603604 10:114938727-114938749 GAGAACTACAACTGCCAAGTAGG - Intronic
1081259783 11:40945319-40945341 GAGAAGAAAAACTGCAAAGTTGG - Intronic
1083010358 11:59391539-59391561 GAGAGCCACAGCTGCCAGGTGGG + Intergenic
1087551104 11:99650226-99650248 GAGAAATATAACTATCAAGTAGG + Intronic
1087988129 11:104710255-104710277 GAGAACTACTAAAGCCAAGCAGG - Intergenic
1089366076 11:117921844-117921866 GAGAACTACAAGTCCCAACAGGG + Intronic
1095412452 12:41939025-41939047 GAGATCTAAATCTGCCAAGCAGG + Intergenic
1099406492 12:82270015-82270037 CAGAACTGTAAATGCCAAGTTGG + Intronic
1101986197 12:109449318-109449340 CAAAACTACAAGTGCAAAGTTGG + Exonic
1106256810 13:28029775-28029797 GAGAAATAAAACTGCCAAGCAGG + Intronic
1106388067 13:29307490-29307512 CAGATCCACAACTGACAAGTTGG - Intronic
1108155414 13:47579183-47579205 CAGCACTATAACTGCCCAGTGGG - Intergenic
1110552693 13:76826649-76826671 GAGAACTGCAACTGACAGCTGGG + Intergenic
1112034656 13:95485855-95485877 GAGAACTACAAGTGAAAAATGGG - Intronic
1115602468 14:34968433-34968455 GAGAACTATAATTTCCAAGGAGG - Intergenic
1117761999 14:59038895-59038917 GAGCACTACTACTTTCAAGTCGG + Intergenic
1119052365 14:71382540-71382562 GAGACCGACAACTGCCAAAATGG - Intronic
1120152324 14:81050480-81050502 GAGAAATACAACTGTCACATGGG - Intronic
1121915898 14:97836748-97836770 GAGAACCAGAACAGCCAAGGTGG + Intergenic
1122578255 14:102755370-102755392 CAGGACTCCAACTGGCAAGTGGG - Intergenic
1133150466 16:3824723-3824745 GGAGACTACAACTGCCAAGCAGG + Intronic
1133463920 16:6011537-6011559 TAGTACTACAACTGCCGTGTAGG + Intergenic
1135118616 16:19745721-19745743 GAGCACCAGAACTGCCCAGTCGG - Intronic
1139772877 16:69293404-69293426 TAGTACTACAAGTGCCAAGTAGG + Intronic
1140923463 16:79560904-79560926 GAGAAATTCAACAGCCATGTAGG + Intergenic
1145022956 17:19446439-19446461 GGGGACTACAACGGCCACGTCGG - Intergenic
1148337600 17:46851857-46851879 GCGAACTCCGACTGCGAAGTGGG - Intronic
1148377254 17:47159662-47159684 GAGGACTACAATGGCCACGTCGG - Intronic
1154443680 18:14415394-14415416 GAGGATTATAACTGACAAGTAGG + Intergenic
1167054651 19:47102049-47102071 GAAAACAAGAACTTCCAAGTGGG + Intronic
1167595619 19:50426428-50426450 GAGATGTAGAACTGCCAAGGAGG + Intronic
1167711479 19:51114139-51114161 GAGAAACAAAACTGGCAAGTTGG + Intergenic
926658316 2:15434859-15434881 CATATCTACAACTGCCAAATGGG + Intronic
927402421 2:22728594-22728616 GAGAAGGAGAAATGCCAAGTGGG - Intergenic
932890170 2:75587996-75588018 GAGAAATACAGCTGCTAAGGAGG + Intergenic
936439701 2:112541343-112541365 AAGAACTACAACTACTCAGTTGG + Exonic
938196421 2:129332971-129332993 GTGAAATACATCTGCCAAATTGG - Intergenic
939100459 2:137889659-137889681 GAGAATTATAACTGAGAAGTAGG - Intergenic
940731373 2:157396894-157396916 GAAAACTAGAACTGCCATCTTGG + Intergenic
941969537 2:171334800-171334822 GAAAAATACAACTAGCAAGTGGG + Intronic
943068874 2:183118050-183118072 AATAAATACAACTGCCCAGTTGG - Intronic
945692179 2:213050783-213050805 AAGCAGTACAACTGGCAAGTAGG + Intronic
948242023 2:236446086-236446108 GAGAAATCCAACAGCCAAGGTGG - Intronic
1173480549 20:43395443-43395465 GATAATTACAACTACCAATTTGG - Intergenic
1177765717 21:25454666-25454688 AAGAAATACAACTGCCAAGGGGG + Intergenic
1177948134 21:27498752-27498774 GTGAATTACAACTGCAAAGCAGG - Intergenic
1178013301 21:28312692-28312714 AAGATCAACAACTTCCAAGTAGG + Intergenic
949405346 3:3708095-3708117 GAGAACTTCTACTCCCAAATTGG - Intronic
951377300 3:21935452-21935474 GAGAACACAAACTGGCAAGTGGG + Intronic
953650851 3:44802221-44802243 GATAACCACAACTGCCCACTGGG - Intronic
953785160 3:45905955-45905977 GAGAACTCAAACTGCCATGAAGG - Intronic
956282466 3:67572047-67572069 GTGAAATGCAACTGCCAGGTAGG + Intronic
958033873 3:88148299-88148321 AAGAACAATAACTGGCAAGTAGG + Intronic
960635912 3:119784337-119784359 GAGAAATACAATGGCCAAGAGGG - Intronic
964742388 3:159980436-159980458 GAGAAATACACCTGCCTGGTGGG - Intergenic
965760733 3:172073317-172073339 GAGAATTACAAATGGAAAGTGGG - Intronic
972323447 4:37993454-37993476 AAGAACTCCATCTACCAAGTGGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
978478651 4:109162528-109162550 GAGACCAACAAAAGCCAAGTAGG - Intronic
978485604 4:109250465-109250487 AAGATCTACAACTGGCAAGCTGG + Intronic
978949550 4:114541139-114541161 AAGAACAAAAACTGACAAGTGGG + Intergenic
981807303 4:148731559-148731581 GAGAAATACATGTGCCAAGTTGG + Intergenic
983556297 4:169062104-169062126 GGGAAAGACAGCTGCCAAGTTGG - Intergenic
984465584 4:180096904-180096926 GAGAACTAAAACTTTTAAGTGGG - Intergenic
984785575 4:183564598-183564620 AAGAAATAAAACTGACAAGTGGG - Intergenic
985312726 4:188619579-188619601 GGGAACTGCAACTGCAATGTGGG + Intergenic
988056384 5:26103004-26103026 GAAAACAAAAACTGACAAGTGGG + Intergenic
990575350 5:57118581-57118603 GAGAAATATAACTGCCAAATAGG + Intergenic
991272681 5:64803660-64803682 GAGAACAACAACTCCAAAGTTGG + Intronic
992244419 5:74804913-74804935 GAGACCTAGAACAGCCCAGTAGG - Intronic
994787136 5:104179810-104179832 GAGAACTACAGCTGCATGGTGGG + Intergenic
994888122 5:105593132-105593154 GAGAACTACAAATGAGAAATGGG - Intergenic
995662578 5:114501413-114501435 GAAAAGTACACCTGCCCAGTGGG + Intergenic
997918453 5:137953016-137953038 AAAAACTACAAGTACCAAGTGGG - Intronic
1001208088 5:169782657-169782679 GAGAAATTCAACAGCCATGTAGG + Intronic
1001480660 5:172086949-172086971 GAGAACTTCAATTGCCCAGAGGG + Intronic
1001518638 5:172374860-172374882 GTGAACTACAAATGCCTAGCAGG - Intronic
1002430477 5:179200640-179200662 GGGAAGTACAGCTGCCAAGTAGG + Intronic
1003836890 6:10081064-10081086 GAGGACTACTGCTGACAAGTAGG + Intronic
1004269018 6:14177289-14177311 TAGAAATACAACTGCCAACTTGG - Intergenic
1005227292 6:23657368-23657390 GAGAACTAAAAGTGTAAAGTGGG - Intergenic
1006257881 6:32845501-32845523 GAGAACCACAGCTGCAGAGTAGG - Exonic
1009951033 6:70396285-70396307 GAGTAGTACAAATGACAAGTAGG + Intergenic
1014882567 6:126741731-126741753 GAGATCTAAAACTGCCAAAGAGG + Intergenic
1015240388 6:131016137-131016159 GAGAACTGTAACTTCCAAGCTGG + Intronic
1017580725 6:155861968-155861990 GAGAACAAAAATTGACAAGTAGG - Intergenic
1019084539 6:169463164-169463186 GAAAACTACAACTTCCAAAGGGG + Intronic
1022755179 7:33279637-33279659 GAGGACTAAAGCTGCCAAGTAGG - Intronic
1023674330 7:42614679-42614701 GAGAGCTACATCTGCCATCTTGG - Intergenic
1027621330 7:80490051-80490073 GAGCACTCCAACTGCAAAGTTGG + Intronic
1028239316 7:88399788-88399810 GATGAAAACAACTGCCAAGTAGG - Intergenic
1030577948 7:111313763-111313785 GCCAACTACAACAGCCAAGAAGG + Intronic
1031270241 7:119639772-119639794 AAGAATTACAACTGCCTAGTAGG + Intergenic
1031888297 7:127263635-127263657 GAGGACTACAACTTCCAACTAGG + Intergenic
1034881323 7:154764719-154764741 GAGAACTGCAACTTGCAACTCGG - Intronic
1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG + Intergenic
1037185649 8:16059191-16059213 AAGAACAAAAATTGCCAAGTGGG - Intergenic
1040978382 8:53219295-53219317 GAGGACATCAACTGCCAGGTAGG - Intergenic
1044408633 8:91860180-91860202 GAGAACTCCACCTGCCAACTAGG - Intergenic
1047212183 8:122849004-122849026 GTGAACTAAAACCGCCAGGTTGG + Intronic
1048819443 8:138366960-138366982 GAGAACCACAACAGCCCAGCTGG + Intronic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1049823169 8:144648605-144648627 AAGAACAACAACTGCCAAGGAGG + Intergenic
1051783820 9:20720622-20720644 AAGAAAAACAACTGGCAAGTAGG - Intronic
1055426439 9:76201499-76201521 GAGAAATACAAGAGCCAAGGAGG + Intronic
1056477779 9:86969404-86969426 GAGAACTATGGCAGCCAAGTGGG - Intergenic
1057694632 9:97314504-97314526 GAGGACTACACCATCCAAGTAGG + Exonic
1058023628 9:100117221-100117243 GGGGACTACAACGGCCACGTCGG - Intronic
1060917544 9:127399995-127400017 GACAACTATACCTGCCAGGTAGG - Exonic
1186781874 X:12920701-12920723 GAGATCTAGAACTTCCAAGTCGG - Exonic
1195732280 X:107979671-107979693 GAGAACTGCCACTGCCAAGGAGG - Intergenic
1196543881 X:116939973-116939995 AATAACTATAACTGCCCAGTGGG - Intergenic
1198106419 X:133466141-133466163 AAAAACAAAAACTGCCAAGTGGG - Intergenic
1199709420 X:150458330-150458352 GAGAAATTCAACTGCTATGTAGG - Intronic