ID: 1074607471

View in Genome Browser
Species Human (GRCh38)
Location 10:114988132-114988154
Sequence TGTCCAGTCATTAGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074607468_1074607471 -1 Left 1074607468 10:114988110-114988132 CCAGAAATAGGCACATTTTTTGT No data
Right 1074607471 10:114988132-114988154 TGTCCAGTCATTAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074607471 Original CRISPR TGTCCAGTCATTAGTGTGGA GGG Intergenic
No off target data available for this crispr