ID: 1074607638

View in Genome Browser
Species Human (GRCh38)
Location 10:114989483-114989505
Sequence ATGTCTCAGCTCAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074607638_1074607640 1 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607640 10:114989507-114989529 TATCCTGCCCTTGGCACTCCTGG No data
1074607638_1074607645 10 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607645 10:114989516-114989538 CTTGGCACTCCTGGTTCTCAGGG No data
1074607638_1074607648 22 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607648 10:114989528-114989550 GGTTCTCAGGGGTTCAGACCTGG No data
1074607638_1074607649 30 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607649 10:114989536-114989558 GGGGTTCAGACCTGGATTCCTGG No data
1074607638_1074607639 -8 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607639 10:114989498-114989520 TGAGACATCTATCCTGCCCTTGG No data
1074607638_1074607646 11 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607646 10:114989517-114989539 TTGGCACTCCTGGTTCTCAGGGG No data
1074607638_1074607644 9 Left 1074607638 10:114989483-114989505 CCTCTCTGCTTGAGCTGAGACAT No data
Right 1074607644 10:114989515-114989537 CCTTGGCACTCCTGGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074607638 Original CRISPR ATGTCTCAGCTCAAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr