ID: 1074608888

View in Genome Browser
Species Human (GRCh38)
Location 10:115002333-115002355
Sequence TTTTTCCAAGAGAGTGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074608888_1074608891 -3 Left 1074608888 10:115002333-115002355 CCACTTCCACTCTCTTGGAAAAA No data
Right 1074608891 10:115002353-115002375 AAACAATTTTATGGAAGCCAAGG No data
1074608888_1074608893 18 Left 1074608888 10:115002333-115002355 CCACTTCCACTCTCTTGGAAAAA No data
Right 1074608893 10:115002374-115002396 GGTTGCCATAGTGCCTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074608888 Original CRISPR TTTTTCCAAGAGAGTGGAAG TGG (reversed) Intergenic
No off target data available for this crispr