ID: 1074608896

View in Genome Browser
Species Human (GRCh38)
Location 10:115002392-115002414
Sequence TGAGGTTGTTTGCTCAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074608894_1074608896 -10 Left 1074608894 10:115002379-115002401 CCATAGTGCCTCTTGAGGTTGTT No data
Right 1074608896 10:115002392-115002414 TGAGGTTGTTTGCTCAGCCAAGG No data
1074608889_1074608896 30 Left 1074608889 10:115002339-115002361 CCACTCTCTTGGAAAAACAATTT No data
Right 1074608896 10:115002392-115002414 TGAGGTTGTTTGCTCAGCCAAGG No data
1074608892_1074608896 -1 Left 1074608892 10:115002370-115002392 CCAAGGTTGCCATAGTGCCTCTT No data
Right 1074608896 10:115002392-115002414 TGAGGTTGTTTGCTCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074608896 Original CRISPR TGAGGTTGTTTGCTCAGCCA AGG Intergenic
No off target data available for this crispr