ID: 1074611279

View in Genome Browser
Species Human (GRCh38)
Location 10:115024590-115024612
Sequence CACCGCCTGAAGGGTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074611275_1074611279 25 Left 1074611275 10:115024542-115024564 CCACTTTGAAGCGAGTGGGAAAA No data
Right 1074611279 10:115024590-115024612 CACCGCCTGAAGGGTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074611279 Original CRISPR CACCGCCTGAAGGGTTACAT TGG Intergenic
No off target data available for this crispr