ID: 1074611440

View in Genome Browser
Species Human (GRCh38)
Location 10:115025845-115025867
Sequence GGGTTGTTCTGAAGGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074611440_1074611448 0 Left 1074611440 10:115025845-115025867 CCCTTTGACCTTCAGAACAACCC No data
Right 1074611448 10:115025868-115025890 ATTTTACAGATAGGGAAATTGGG No data
1074611440_1074611444 -8 Left 1074611440 10:115025845-115025867 CCCTTTGACCTTCAGAACAACCC No data
Right 1074611444 10:115025860-115025882 AACAACCCATTTTACAGATAGGG No data
1074611440_1074611443 -9 Left 1074611440 10:115025845-115025867 CCCTTTGACCTTCAGAACAACCC No data
Right 1074611443 10:115025859-115025881 GAACAACCCATTTTACAGATAGG No data
1074611440_1074611447 -1 Left 1074611440 10:115025845-115025867 CCCTTTGACCTTCAGAACAACCC No data
Right 1074611447 10:115025867-115025889 CATTTTACAGATAGGGAAATTGG No data
1074611440_1074611449 28 Left 1074611440 10:115025845-115025867 CCCTTTGACCTTCAGAACAACCC No data
Right 1074611449 10:115025896-115025918 AAGTTTCAGTAACTTATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074611440 Original CRISPR GGGTTGTTCTGAAGGTCAAA GGG (reversed) Intergenic
No off target data available for this crispr