ID: 1074614223

View in Genome Browser
Species Human (GRCh38)
Location 10:115050556-115050578
Sequence CAAGATGGAGTCGCTCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074614223_1074614234 28 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614234 10:115050607-115050629 ACCTACTGGGCTGCATTCCCAGG 0: 239
1: 376
2: 324
3: 235
4: 252
1074614223_1074614231 0 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614231 10:115050579-115050601 AATACGGGCTGGGTAAAACAGGG No data
1074614223_1074614233 15 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614233 10:115050594-115050616 AAACAGGGCTGAGACCTACTGGG No data
1074614223_1074614228 -10 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614228 10:115050569-115050591 CTCCATCTTGAATACGGGCTGGG No data
1074614223_1074614232 14 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614232 10:115050593-115050615 AAAACAGGGCTGAGACCTACTGG No data
1074614223_1074614230 -1 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074614223 Original CRISPR CAAGATGGAGTCGCTCTGGT TGG (reversed) Intergenic
No off target data available for this crispr