ID: 1074614224

View in Genome Browser
Species Human (GRCh38)
Location 10:115050560-115050582
Sequence TATTCAAGATGGAGTCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2931
Summary {0: 71, 1: 712, 2: 926, 3: 713, 4: 509}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074614224_1074614231 -4 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614231 10:115050579-115050601 AATACGGGCTGGGTAAAACAGGG No data
1074614224_1074614230 -5 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG No data
1074614224_1074614236 27 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614236 10:115050610-115050632 TACTGGGCTGCATTCCCAGGAGG 0: 212
1: 655
2: 577
3: 362
4: 355
1074614224_1074614233 11 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614233 10:115050594-115050616 AAACAGGGCTGAGACCTACTGGG No data
1074614224_1074614232 10 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614232 10:115050593-115050615 AAAACAGGGCTGAGACCTACTGG No data
1074614224_1074614234 24 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614234 10:115050607-115050629 ACCTACTGGGCTGCATTCCCAGG 0: 239
1: 376
2: 324
3: 235
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074614224 Original CRISPR TATTCAAGATGGAGTCGCTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr