ID: 1074614230

View in Genome Browser
Species Human (GRCh38)
Location 10:115050578-115050600
Sequence GAATACGGGCTGGGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074614224_1074614230 -5 Left 1074614224 10:115050560-115050582 CCAGAGCGACTCCATCTTGAATA 0: 71
1: 712
2: 926
3: 713
4: 509
Right 1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG No data
1074614223_1074614230 -1 Left 1074614223 10:115050556-115050578 CCAACCAGAGCGACTCCATCTTG No data
Right 1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG No data
1074614222_1074614230 3 Left 1074614222 10:115050552-115050574 CCTTCCAACCAGAGCGACTCCAT No data
Right 1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074614230 Original CRISPR GAATACGGGCTGGGTAAAAC AGG Intergenic
No off target data available for this crispr