ID: 1074615919

View in Genome Browser
Species Human (GRCh38)
Location 10:115068002-115068024
Sequence GGGGCTTGACTAGAAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074615915_1074615919 6 Left 1074615915 10:115067973-115067995 CCTAAGCTTGGTAAAGATCAGTC No data
Right 1074615919 10:115068002-115068024 GGGGCTTGACTAGAAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074615919 Original CRISPR GGGGCTTGACTAGAAAACAC TGG Intergenic
No off target data available for this crispr