ID: 1074616076

View in Genome Browser
Species Human (GRCh38)
Location 10:115069451-115069473
Sequence ACTCATGCTGTTTTTCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074616069_1074616076 19 Left 1074616069 10:115069409-115069431 CCATGGAGAGGCTAGCTTTGTGG No data
Right 1074616076 10:115069451-115069473 ACTCATGCTGTTTTTCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074616076 Original CRISPR ACTCATGCTGTTTTTCATTG GGG Intergenic
No off target data available for this crispr