ID: 1074617484

View in Genome Browser
Species Human (GRCh38)
Location 10:115083943-115083965
Sequence CTCTGCACAAGGACCCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074617484_1074617489 9 Left 1074617484 10:115083943-115083965 CCCCACTGGGTCCTTGTGCAGAG No data
Right 1074617489 10:115083975-115083997 GAAGCTGACACAGTTCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074617484 Original CRISPR CTCTGCACAAGGACCCAGTG GGG (reversed) Intergenic
No off target data available for this crispr