ID: 1074618196

View in Genome Browser
Species Human (GRCh38)
Location 10:115092326-115092348
Sequence GATGACTTTCCAAGATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074618196_1074618198 2 Left 1074618196 10:115092326-115092348 CCAGCCAATCTTGGAAAGTCATC No data
Right 1074618198 10:115092351-115092373 AAGAAGAAAAAGTGCTGCTGAGG No data
1074618196_1074618200 13 Left 1074618196 10:115092326-115092348 CCAGCCAATCTTGGAAAGTCATC No data
Right 1074618200 10:115092362-115092384 GTGCTGCTGAGGAAGGAAAACGG No data
1074618196_1074618202 25 Left 1074618196 10:115092326-115092348 CCAGCCAATCTTGGAAAGTCATC No data
Right 1074618202 10:115092374-115092396 AAGGAAAACGGCCCTTTTGTGGG No data
1074618196_1074618199 6 Left 1074618196 10:115092326-115092348 CCAGCCAATCTTGGAAAGTCATC No data
Right 1074618199 10:115092355-115092377 AGAAAAAGTGCTGCTGAGGAAGG No data
1074618196_1074618201 24 Left 1074618196 10:115092326-115092348 CCAGCCAATCTTGGAAAGTCATC No data
Right 1074618201 10:115092373-115092395 GAAGGAAAACGGCCCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074618196 Original CRISPR GATGACTTTCCAAGATTGGC TGG (reversed) Intergenic
No off target data available for this crispr