ID: 1074618202

View in Genome Browser
Species Human (GRCh38)
Location 10:115092374-115092396
Sequence AAGGAAAACGGCCCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074618196_1074618202 25 Left 1074618196 10:115092326-115092348 CCAGCCAATCTTGGAAAGTCATC No data
Right 1074618202 10:115092374-115092396 AAGGAAAACGGCCCTTTTGTGGG No data
1074618197_1074618202 21 Left 1074618197 10:115092330-115092352 CCAATCTTGGAAAGTCATCTGAA No data
Right 1074618202 10:115092374-115092396 AAGGAAAACGGCCCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074618202 Original CRISPR AAGGAAAACGGCCCTTTTGT GGG Intergenic
No off target data available for this crispr