ID: 1074618529

View in Genome Browser
Species Human (GRCh38)
Location 10:115093626-115093648
Sequence GACGGGCGCCGGTGAGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074618519_1074618529 3 Left 1074618519 10:115093600-115093622 CCCTCCTGACCGGGGAGCGGGAC 0: 1
1: 0
2: 0
3: 10
4: 75
Right 1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG 0: 1
1: 0
2: 1
3: 34
4: 261
1074618521_1074618529 -1 Left 1074618521 10:115093604-115093626 CCTGACCGGGGAGCGGGACTCGG 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG 0: 1
1: 0
2: 1
3: 34
4: 261
1074618520_1074618529 2 Left 1074618520 10:115093601-115093623 CCTCCTGACCGGGGAGCGGGACT 0: 1
1: 0
2: 0
3: 14
4: 79
Right 1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG 0: 1
1: 0
2: 1
3: 34
4: 261
1074618524_1074618529 -6 Left 1074618524 10:115093609-115093631 CCGGGGAGCGGGACTCGGACGGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG 0: 1
1: 0
2: 1
3: 34
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074618529 Original CRISPR GACGGGCGCCGGTGAGGAGG AGG Exonic
900548205 1:3240540-3240562 GACGGAGCCCGGTGCGGAGGAGG - Intronic
900931599 1:5741633-5741655 GCAGGAAGCCGGTGAGGAGGCGG - Intergenic
902856528 1:19210221-19210243 GACGAGCGGCGGCGAAGAGGCGG - Exonic
903576924 1:24345041-24345063 GAGGGGCACAGGTGTGGAGGGGG - Intronic
903576991 1:24345258-24345280 GAGGGGCACAGGTGTGGAGGGGG - Intronic
904002916 1:27349028-27349050 TACGGGGGCTGGTGAGGAAGAGG - Intronic
904618080 1:31760683-31760705 GGCGAGCGCCGGGGAGGCGGAGG - Intronic
905995895 1:42380583-42380605 GGCGGGCGCAGGCGAGGCGGAGG - Intergenic
906204510 1:43979663-43979685 GAGGGGCGCCGGAGTGGGGGCGG - Intronic
906403349 1:45521740-45521762 GGCGGGCCCCGGACAGGAGGAGG + Exonic
906518985 1:46456297-46456319 GCTGGGCCCCGGGGAGGAGGGGG + Intergenic
908014249 1:59814927-59814949 GGCGGGGGCGGGTGAGGAGGGGG + Exonic
908250464 1:62261559-62261581 GAAGGGAGCAGGAGAGGAGGTGG - Intronic
908683531 1:66689210-66689232 GATGGAGGCCGGGGAGGAGGTGG - Exonic
918215942 1:182391930-182391952 GGCGGGCGCCGCTGGGGTGGGGG + Exonic
920259361 1:204678523-204678545 GTCTGGAGCTGGTGAGGAGGGGG - Intronic
920605156 1:207375173-207375195 AAAGGCCGCCGGAGAGGAGGAGG + Intergenic
920700992 1:208217928-208217950 GAGGGGCGGCGGTGAGGAGACGG + Exonic
920732564 1:208501468-208501490 GACAGCAGCCAGTGAGGAGGAGG + Intergenic
923506167 1:234608686-234608708 GCCGGGCCCCGGTGCGCAGGCGG + Exonic
924436558 1:244048608-244048630 GGCGGGCGCGGGGGAGGGGGAGG - Intergenic
1062774698 10:135479-135501 GCCGGGCGGCGGGAAGGAGGCGG + Intronic
1063201725 10:3790786-3790808 GAAGTGTGCCGGTGAGGAGATGG + Intergenic
1064888471 10:20139839-20139861 CACGGGGGCCGGTCAGGGGGTGG + Intronic
1069871591 10:71536333-71536355 GACTGGGGCTAGTGAGGAGGAGG + Intronic
1070796756 10:79221439-79221461 GAGGGGGCCTGGTGAGGAGGAGG - Intronic
1073196266 10:101694613-101694635 GGCGGCGGCCGGGGAGGAGGAGG - Exonic
1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG + Exonic
1075498881 10:122954067-122954089 GACCGGCCCGGGTGAGGAGGAGG + Exonic
1076402782 10:130194560-130194582 GACGGGTGGTGGGGAGGAGGAGG + Intergenic
1076874736 10:133210577-133210599 GGCGGGCGGCGGTGAGGTGGTGG - Intronic
1077198098 11:1291548-1291570 GAGGGGCGTCAGTGAGGATGGGG - Intronic
1077253739 11:1571770-1571792 GGTGGGCGCCCGGGAGGAGGAGG - Intronic
1077391281 11:2301755-2301777 GACGGCGCCCGGGGAGGAGGAGG - Exonic
1077923125 11:6655930-6655952 GGCGGGCGCCGGGGGGAAGGGGG - Intergenic
1078332300 11:10434924-10434946 GACAAGCGCTGGTGAGGATGTGG + Intronic
1078608903 11:12802486-12802508 GTCGGGCGGCGGTGAGATGGGGG - Intronic
1079023269 11:16925706-16925728 GAAAGGCCCCGGCGAGGAGGAGG - Intronic
1079251616 11:18791539-18791561 TCCGGGCGCCGGCGAGCAGGCGG + Exonic
1083592828 11:63905247-63905269 GAGGGGTGCCTGTGAGGAGTTGG - Intronic
1083651968 11:64209146-64209168 GTAGGGAGCTGGTGAGGAGGGGG + Intronic
1084672786 11:70616843-70616865 GACAGGGGCCGCTGAGGAAGAGG + Intronic
1089527647 11:119107652-119107674 GGCGGGCCGCGGGGAGGAGGTGG - Exonic
1089617248 11:119701849-119701871 GGCGGGAGCCAGTGAGGCGGAGG - Intronic
1091021387 11:132103166-132103188 GAGAGAGGCCGGTGAGGAGGAGG - Intronic
1091631692 12:2166233-2166255 GACTGGAGCTGGTGAGGAGGGGG - Intronic
1092127392 12:6084520-6084542 GGCGGGTGCAGGGGAGGAGGAGG + Intronic
1094485905 12:30926207-30926229 GATGGGGGCTGGTGAGGAAGGGG + Intergenic
1096335522 12:50752397-50752419 GACGGACTCCAGTGAGCAGGTGG + Intergenic
1096616824 12:52838002-52838024 GACCAGAGCCGGTGAGGATGTGG - Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101879010 12:108613893-108613915 GCTGGGTGCCGGGGAGGAGGTGG - Intergenic
1103626693 12:122225683-122225705 GACGAGGGCTGGTCAGGAGGCGG + Intronic
1103920280 12:124395705-124395727 GGTGGTCACCGGTGAGGAGGTGG + Intronic
1106290518 13:28357175-28357197 GAGGGGGGTAGGTGAGGAGGGGG - Intronic
1112461071 13:99604392-99604414 CACAGGCCCCTGTGAGGAGGTGG + Intergenic
1113813251 13:113154387-113154409 GCGGGGCGCGGGGGAGGAGGAGG + Intergenic
1113930098 13:113963631-113963653 GACGGGCGAGGCTGAGGAGAGGG - Intergenic
1116945567 14:50831682-50831704 GGCGGGAGCCTGTGAGGACGTGG - Intergenic
1118627670 14:67674363-67674385 GGCGGGGACCGGTGAGGCGGGGG - Exonic
1121439461 14:93939687-93939709 GGCGGGCGCGGGTGAGGGGAGGG + Intronic
1121567250 14:94919280-94919302 GCCCGGTGCCGGAGAGGAGGTGG + Intergenic
1122951544 14:105047772-105047794 GACGGGCGCAGCTGGGGAGGTGG - Intergenic
1122971749 14:105155029-105155051 GACGGGAGGCTGTGAGGGGGAGG - Intronic
1125626980 15:41116512-41116534 GAAAGGCGGCGGGGAGGAGGAGG + Intergenic
1128374466 15:67065516-67065538 GCGGGGCGCGGGGGAGGAGGCGG + Intronic
1128582398 15:68818952-68818974 GGCGGCCGCGGGAGAGGAGGGGG - Intronic
1129414609 15:75368340-75368362 GGCAGGGGCCGGGGAGGAGGGGG - Intronic
1132040577 15:98521929-98521951 GGGGGGCGGGGGTGAGGAGGAGG - Intergenic
1132398310 15:101489798-101489820 GGCGGGAGCCGGGGAGGAGGAGG + Exonic
1132654361 16:1035739-1035761 GACAGAAGCCAGTGAGGAGGCGG + Intergenic
1132779025 16:1612814-1612836 GACGCGAGCCGGTGCGGAGCGGG + Intronic
1132847836 16:2008902-2008924 GGGGGGCGGCGGCGAGGAGGAGG + Intronic
1133271800 16:4614161-4614183 GCCGGGCACCGGGGAGGTGGCGG - Intronic
1135474018 16:22757490-22757512 GATGGGAGCCAGTGAAGAGGAGG + Intergenic
1136546647 16:30958374-30958396 GCCGCTGGCCGGTGAGGAGGCGG + Intronic
1136683663 16:31981988-31982010 GGCCGGCGCAGGTGAGGACGAGG + Intergenic
1136695649 16:32078636-32078658 AACAGGCGCTGGTGAGGATGTGG + Intergenic
1136796144 16:33021885-33021907 AACAGGCGCTGGTGAGGATGTGG + Intergenic
1136873773 16:33832513-33832535 AACAGGCGCTGGTGAGGATGTGG - Intergenic
1136913945 16:34163716-34163738 GACGCGCGCCGGGTAGGCGGGGG - Intergenic
1137926726 16:52547335-52547357 GAGGGGCCCCGGAGAGGGGGCGG - Intronic
1140137400 16:72219480-72219502 GTCGGGGGCCTGTGAGGATGGGG + Intergenic
1141132333 16:81444896-81444918 GGCGGGCGCCGGGGTGGGGGCGG - Intergenic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1203098402 16_KI270728v1_random:1283543-1283565 AACAGGCGCTGGTGAGGACGTGG + Intergenic
1142586902 17:979615-979637 GACGGGCGGCGGCGAGGAGGTGG - Exonic
1142596318 17:1031636-1031658 GCCGGGCGCCGGTGTTGGGGGGG + Intronic
1143099870 17:4499077-4499099 GGCGGGCGGCGCGGAGGAGGAGG + Exonic
1143487497 17:7262705-7262727 GACCGCCGCTGGGGAGGAGGCGG + Intronic
1143811929 17:9478848-9478870 GAAGGGAGCTGATGAGGAGGTGG - Intronic
1144269146 17:13600940-13600962 GTCCGGCGGCGGCGAGGAGGCGG - Exonic
1147144582 17:38477695-38477717 GGCCGGCGCAGGTGAGGACGAGG + Exonic
1147429636 17:40363485-40363507 GGCGGGCGGCGCTGAGGCGGCGG - Exonic
1147774330 17:42889939-42889961 GGCGGGCGGCGGGGAGGGGGCGG + Intergenic
1148095681 17:45051496-45051518 GCCGGGCGCCGGGGAGGGGGCGG - Intronic
1148128334 17:45248040-45248062 GGCGGGTGCCTGGGAGGAGGTGG + Intergenic
1148782596 17:50130083-50130105 GGAGGGCGGCGGGGAGGAGGCGG + Intergenic
1149512684 17:57256423-57256445 CACGTGCGCCGGGGAGGAGGGGG + Intronic
1149993547 17:61395830-61395852 GACGGGCGGCGGTGGGGGAGTGG - Intergenic
1151203578 17:72488138-72488160 AGGTGGCGCCGGTGAGGAGGGGG - Intergenic
1151309789 17:73286029-73286051 GGAGGGCGGCGATGAGGAGGCGG - Exonic
1151393004 17:73800509-73800531 GTTGGGTGCAGGTGAGGAGGAGG + Intergenic
1151868797 17:76822574-76822596 GAAGGAGGCCAGTGAGGAGGAGG + Intergenic
1152362401 17:79838897-79838919 GACGGGAGGCGGGGTGGAGGTGG - Intronic
1152468076 17:80476796-80476818 GGCGGGGGCGGGGGAGGAGGGGG - Intronic
1152928917 17:83100257-83100279 GGGGGGCTCCGGTGAGGGGGAGG + Intergenic
1153900641 18:9614572-9614594 GAGGGGCGGCGGGGAGGAGGAGG + Intronic
1153972491 18:10239161-10239183 GAAGGGCGGTGGGGAGGAGGAGG + Intergenic
1154377919 18:13824090-13824112 GACAGCCGGCGGTGCGGAGGCGG + Intergenic
1155025239 18:21934960-21934982 GAAGGGTGCCTTTGAGGAGGAGG - Intergenic
1157600885 18:48892548-48892570 GCTGGGCGCCCGTGAGGAGGTGG + Intergenic
1160243365 18:77138160-77138182 GACGTGGGCCGGTGAGCATGTGG + Intergenic
1160694082 19:474241-474263 GAGGGGCGCGTGTGCGGAGGCGG - Intronic
1160752891 19:743033-743055 TACGAGCGCTGGTGAGGACGTGG - Intronic
1160766448 19:810721-810743 GATGGGCTCCGTGGAGGAGGCGG + Exonic
1160772859 19:840861-840883 AACGGACTCCGGGGAGGAGGTGG - Intergenic
1160790046 19:918989-919011 GGCGGGCGCATGTGGGGAGGGGG + Intronic
1160865830 19:1255575-1255597 GTCGGGGGCCGGTGAGGCCGGGG - Exonic
1161732965 19:5973413-5973435 GACTGGCGGGGATGAGGAGGGGG + Intronic
1162018067 19:7856351-7856373 GACGGGGAGGGGTGAGGAGGAGG + Intronic
1163148641 19:15398687-15398709 GCCGGGCGCCGGCGAGGCTGAGG + Intronic
1163217949 19:15894749-15894771 GACGGGCGAGGCTGAGCAGGGGG - Intronic
1163793214 19:19320430-19320452 GGCGGCCGCCTGAGAGGAGGCGG + Intronic
1164835066 19:31350717-31350739 TACGGGCGGCGGTGAGGGCGCGG + Intergenic
1165079383 19:33298794-33298816 GGCGGCCGTGGGTGAGGAGGCGG + Intergenic
1165091261 19:33389498-33389520 GATGGGCGGCGGTGGGGTGGGGG - Intronic
1165121672 19:33562992-33563014 GAAAGGCACCAGTGAGGAGGCGG + Intergenic
1165459576 19:35936624-35936646 GACCGGCTGCGGTGGGGAGGGGG - Intronic
1165993008 19:39826718-39826740 GAGGGGCGCGGGCGAGGTGGAGG + Exonic
1166514935 19:43439439-43439461 GGCGGGGGCCGGGGTGGAGGCGG - Intergenic
1166792240 19:45405121-45405143 GGCGGGTCCCGGTGGGGAGGGGG + Intronic
1166840698 19:45695386-45695408 GACGGGGACTGGGGAGGAGGTGG - Intronic
1167432289 19:49461643-49461665 GAGGGGCGCCGGGGAGGCCGGGG - Exonic
1168110618 19:54189667-54189689 GACGGGCTCTGGAAAGGAGGCGG + Exonic
1168649650 19:58085242-58085264 GTCGGGCACCACTGAGGAGGAGG - Exonic
925056382 2:860617-860639 GCCGGGGGCTGGTGTGGAGGGGG - Intergenic
929107096 2:38376647-38376669 GATGGGCCCCGCGGAGGAGGAGG - Intronic
929948725 2:46389826-46389848 GACGGGAGCTGGGAAGGAGGGGG + Intergenic
932030292 2:68177023-68177045 GGCGGGCGGGGGTGGGGAGGAGG - Intronic
932201256 2:69830093-69830115 GACGGACGAGGATGAGGAGGAGG + Exonic
934566870 2:95346300-95346322 GCCGGGAGCCCGAGAGGAGGGGG - Intronic
934646885 2:96064066-96064088 GAAGGTGGCCGGGGAGGAGGTGG - Intergenic
934840283 2:97620148-97620170 GAAGGTGGCCGGGGAGGAGGTGG - Intergenic
935217193 2:100983565-100983587 GAGGGGAGCAGGTGGGGAGGTGG - Intronic
936531118 2:113277734-113277756 TCCGGGCGCAGGTGGGGAGGGGG + Intronic
937160932 2:119760173-119760195 GGCCGGCGCCGCTGGGGAGGTGG - Exonic
939479756 2:142733354-142733376 AACAGGCGCCGGAGAGGATGTGG + Intergenic
939612958 2:144332353-144332375 GGCGGGCGCCGGGGAGGGGAGGG + Intronic
942240832 2:173963799-173963821 GCCGGGCGACGACGAGGAGGAGG - Exonic
942696919 2:178656763-178656785 GACAGGCGCTGGAGAGGATGTGG + Intronic
942697358 2:178661024-178661046 GACAGGCGCTGGAGAGGATGTGG + Intronic
943624248 2:190180883-190180905 GCCGGGCGCCGGCGAGAAGGCGG + Exonic
943645940 2:190408216-190408238 GGCCGGGGCCGGGGAGGAGGAGG + Intergenic
947718120 2:232351967-232351989 GGCGCGCGCCGGTGAGGAAGGGG - Intergenic
947861242 2:233359865-233359887 GACGGGTGCTGATGAGGAGAGGG + Intronic
1168913239 20:1466758-1466780 GACGGGCGCCGAGGAGGACCGGG - Exonic
1168953666 20:1819553-1819575 GACAGGCGAAGGAGAGGAGGTGG - Intergenic
1170756866 20:19212671-19212693 GACGGGCAGCGGCGAGGAGGAGG + Exonic
1171810474 20:29742145-29742167 GGCGGGGGCGGATGAGGAGGGGG + Intergenic
1173489177 20:43465609-43465631 GAGGGGTGGCGGGGAGGAGGGGG + Intergenic
1174042849 20:47712359-47712381 GAGGTGCCACGGTGAGGAGGAGG - Intronic
1174045444 20:47729667-47729689 GAGAGGCGCCGGGGAGGCGGGGG + Intronic
1174346805 20:49936367-49936389 AACGGCGGCCGATGAGGAGGAGG - Intergenic
1175250202 20:57604580-57604602 GAGGGGAGCTGGTGGGGAGGTGG - Exonic
1176548454 21:8211859-8211881 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176550155 21:8217346-8217368 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176556348 21:8256067-8256089 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176556824 21:8257543-8257565 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1176567385 21:8394894-8394916 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176569083 21:8400381-8400403 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176575287 21:8439109-8439131 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176575763 21:8440584-8440606 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1176576997 21:8444616-8444638 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1179718877 21:43304327-43304349 GAGGGGCGCCCATGAGGACGCGG + Intergenic
1180041761 21:45283790-45283812 CACGGGCCCCTGTGAGGATGGGG - Intronic
1183350674 22:37333042-37333064 GTCGGGGGCAGGTGAGGAGCAGG - Intergenic
1184030981 22:41894590-41894612 GATGAGCTCCGGTGGGGAGGGGG - Intronic
1185283099 22:49983987-49984009 GACGGGCTGCGGGGAGGGGGGGG - Intergenic
1203253338 22_KI270733v1_random:128164-128186 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1203253814 22_KI270733v1_random:129638-129660 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1203255048 22_KI270733v1_random:133678-133700 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203261392 22_KI270733v1_random:173242-173264 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1203261870 22_KI270733v1_random:174717-174739 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1203263104 22_KI270733v1_random:178757-178779 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
949987756 3:9553507-9553529 GACCGGGGCCGGTGAGCAGCGGG + Intronic
950546170 3:13639313-13639335 GATGGGGGCCGGCGAGGAGCAGG - Intergenic
953925301 3:46979656-46979678 GGCGGCCGGCAGTGAGGAGGAGG + Intronic
953925341 3:46979799-46979821 GGCGGGCGGCGCGGAGGAGGCGG + Exonic
954539556 3:51384707-51384729 GGCGGGCTCCGGTCAGGTGGAGG + Intergenic
955015355 3:55064393-55064415 GCCAGGTGCCGGTGAGGTGGGGG + Intronic
955209662 3:56928894-56928916 CACGGGCCTCAGTGAGGAGGTGG + Intronic
956699876 3:71949472-71949494 CACGGGGGCTGGGGAGGAGGAGG - Intergenic
962180534 3:133201456-133201478 CACGGGGGCCTGTCAGGAGGTGG - Intronic
964208280 3:154199194-154199216 GTCGGGGGCTGGGGAGGAGGTGG - Intronic
966108160 3:176362254-176362276 GACCGGCGCCGCGGAGCAGGGGG + Intergenic
967272539 3:187743333-187743355 GGCGGGGGCCGGCGGGGAGGGGG + Intronic
967858277 3:194134355-194134377 GGCGGGCGCCCGGGAGGAGGCGG - Intergenic
968434754 4:578683-578705 GGCAGACGCCGGTGAGGACGTGG - Intergenic
968653809 4:1770233-1770255 GAGGAGGGCTGGTGAGGAGGGGG + Intergenic
968815186 4:2818268-2818290 GGCGGGCGCCCGGGACGAGGCGG + Exonic
968942917 4:3648457-3648479 GTGGGGAGCAGGTGAGGAGGAGG - Intergenic
968945869 4:3663878-3663900 GATGGGCAACGGTGATGAGGTGG + Intergenic
970399472 4:15703487-15703509 GATGGGGGCGAGTGAGGAGGGGG + Intronic
973764250 4:54149338-54149360 GCCGGGCGCCGCGGAGCAGGGGG + Intronic
984744117 4:183196840-183196862 GACGGGGACCTGTGAGGTGGAGG - Intronic
988242531 5:28632518-28632540 GACAGGAGCCGGGCAGGAGGGGG + Intergenic
988577912 5:32444522-32444544 GGCAGGCTCCGGGGAGGAGGCGG - Intronic
990446510 5:55898272-55898294 AACAGGCGACGGGGAGGAGGCGG - Intronic
990581895 5:57173809-57173831 GTCGGGCGCCTGGGGGGAGGGGG - Intergenic
992528926 5:77637323-77637345 GACAAGCGCGGGTGCGGAGGGGG - Intronic
992566431 5:77999472-77999494 GACGGGAGCCGGCGGGGAAGAGG + Intergenic
997582769 5:135027919-135027941 CACGGCGGGCGGTGAGGAGGGGG + Exonic
998957414 5:147452634-147452656 GCTGGGCGCCGGTGAAGACGCGG + Intronic
999062768 5:148653997-148654019 CACGGGTGCCGGTGGGGACGCGG - Intronic
1000060609 5:157652035-157652057 AACGGGCGCGGCTGAGGCGGCGG + Exonic
1001081834 5:168672927-168672949 GACGGGCAAGGGTGAGAAGGGGG - Intronic
1001808453 5:174608982-174609004 GAGGGGAGCGGGTGAGAAGGTGG + Intergenic
1003049906 6:2770434-2770456 GCCGGGCGTCAGTGAGGAGAGGG + Intronic
1003901482 6:10659596-10659618 GAGGGGAGAAGGTGAGGAGGGGG + Intergenic
1004924470 6:20403703-20403725 GGCGGGCGCCGGTGGGGGGGTGG - Intronic
1006090713 6:31627145-31627167 GCGGGGCCCCGGTGAGGTGGGGG - Exonic
1006187733 6:32190238-32190260 GAGGGGAGCCGGAGAGGAAGAGG + Intergenic
1006257546 6:32843773-32843795 GAGGGTCGCCTGAGAGGAGGAGG - Intronic
1006367007 6:33621711-33621733 GAGGGGCGCGGGTAAAGAGGGGG + Intronic
1006453287 6:34117696-34117718 CATGGGGGCAGGTGAGGAGGTGG - Intronic
1007614593 6:43172410-43172432 GACCGGCGCCAGAGAGGAAGAGG + Intronic
1013619428 6:111873354-111873376 GAGCGGAGCCGGCGAGGAGGGGG - Exonic
1014561464 6:122896172-122896194 GACGGGGGCGGGTCAGGGGGTGG - Intergenic
1015773544 6:136792293-136792315 AGAGGGCGCCGGAGAGGAGGCGG - Exonic
1019298222 7:290105-290127 GGCGGGCGGCGCGGAGGAGGCGG + Intergenic
1019472837 7:1230271-1230293 GAAGGGCGCGGGGGAGGGGGAGG + Intergenic
1019515184 7:1436730-1436752 GACCGGCTCCGGTGAGGGGCAGG - Exonic
1019731504 7:2631916-2631938 GACGGGCGGGGGTGCGGAGGGGG + Intergenic
1022628726 7:32065069-32065091 GCCGGGGGCCAGTGAGGGGGAGG + Intronic
1022697866 7:32728165-32728187 AGCGGCCGCCGGAGAGGAGGCGG + Intergenic
1023722902 7:43113499-43113521 GACGGGTGCAGGAGGGGAGGAGG + Intronic
1027626504 7:80551458-80551480 GGCGGGCGCCTGGGAGGATGAGG + Intronic
1028796392 7:94908068-94908090 GGGGGGCGCCTGCGAGGAGGGGG + Intronic
1029413696 7:100430358-100430380 GAGGAGCGCCGGGGAGGGGGCGG + Exonic
1029546234 7:101211973-101211995 GACGGCGGCAGGTGGGGAGGCGG + Intronic
1030033204 7:105388143-105388165 GGCGGGGGCCGGGGAGGAAGGGG + Intronic
1033421879 7:141210927-141210949 GCAGGGCGCCCTTGAGGAGGAGG + Intronic
1034439169 7:151077772-151077794 GAGGGGTGCCTGTGGGGAGGCGG + Exonic
1034441010 7:151086217-151086239 GGTGGGGGCTGGTGAGGAGGCGG + Intronic
1034528878 7:151683231-151683253 GGCAGGCGCTGGAGAGGAGGAGG + Intronic
1034800152 7:154051420-154051442 GAAGGGAGCCGGGGAGGACGCGG + Intronic
1035263733 7:157677092-157677114 GAGGGGCGCAGGAAAGGAGGTGG - Intronic
1035580999 8:738827-738849 GGTGGGCGCCGGCGAGAAGGCGG + Intergenic
1036175915 8:6538497-6538519 CAGGGGCGCCAGTCAGGAGGCGG - Intronic
1036466492 8:9002785-9002807 GAGGCGCGCCGGTGAGAAGACGG - Exonic
1037583507 8:20261012-20261034 GACGGGGGCAGGTGAGAAGATGG - Intronic
1037843553 8:22262901-22262923 GACGGGCGGTGGGTAGGAGGGGG - Intergenic
1038807990 8:30812473-30812495 GCCGGGGGCGGGTGGGGAGGGGG - Exonic
1038963719 8:32548910-32548932 GACGGGCGAGGGAGAGGGGGAGG - Intronic
1039479809 8:37864124-37864146 GACGGCCACGGGTGAGGACGGGG - Intronic
1042253679 8:66781570-66781592 GAAGGGCCTCGGTGAGGAAGTGG - Intronic
1043441950 8:80283948-80283970 GCCGGGAGCCAGAGAGGAGGAGG + Intergenic
1047539515 8:125751014-125751036 GACAGGCGGTGGTGGGGAGGTGG + Intergenic
1049510417 8:143024360-143024382 GATGGGCTGCGGAGAGGAGGGGG - Intergenic
1049597670 8:143492245-143492267 GTGGGTGGCCGGTGAGGAGGGGG - Intronic
1049673040 8:143878160-143878182 CCCGGGCGCCGGTGAAGAGGAGG - Intronic
1049789626 8:144466725-144466747 CAGGGGCGCCCCTGAGGAGGGGG - Intronic
1050173717 9:2849018-2849040 GACAGGTGCTGGTGAGGATGTGG + Intergenic
1053433379 9:38058712-38058734 GAGCGGAGCAGGTGAGGAGGAGG - Intronic
1054824372 9:69557487-69557509 GGAGGGAGCGGGTGAGGAGGAGG - Intronic
1056787913 9:89605823-89605845 CGTGGGCGCCGGCGAGGAGGCGG + Exonic
1058762557 9:108149279-108149301 GAAGGGGGCTGGGGAGGAGGAGG - Intergenic
1060441646 9:123645415-123645437 GATGGGGGCTGGTGCGGAGGGGG - Intronic
1060700671 9:125747123-125747145 GGCGCGCGGCGGCGAGGAGGCGG + Intergenic
1061483512 9:130908843-130908865 CATGGGCCCCGGTGAGGAGGGGG + Intronic
1061709978 9:132480746-132480768 GCCAGGCGCCGGTGAGGAGAGGG + Intronic
1061824761 9:133251235-133251257 GGTGGGGGGCGGTGAGGAGGGGG + Intronic
1062421105 9:136483178-136483200 GACGGACGCCGGCGAGGGGCGGG - Intronic
1062464643 9:136675652-136675674 GACGGGCGGCTGTGATGGGGTGG - Intronic
1062567312 9:137168952-137168974 GGAGGGCGGCGGTGCGGAGGCGG + Exonic
1062595058 9:137295712-137295734 GCCCGGCGCAGGTGGGGAGGGGG - Intergenic
1203469738 Un_GL000220v1:111311-111333 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1203470214 Un_GL000220v1:112786-112808 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1203471448 Un_GL000220v1:116818-116840 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203477559 Un_GL000220v1:155283-155305 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1203478035 Un_GL000220v1:156758-156780 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1203479269 Un_GL000220v1:160790-160812 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1187443813 X:19343746-19343768 GCCGCGGGCGGGTGAGGAGGCGG - Intergenic
1189329381 X:40134044-40134066 GAGGGGCTCCGCAGAGGAGGTGG + Intronic
1190225224 X:48539869-48539891 GGCGGCGGCCGCTGAGGAGGAGG + Exonic
1192780830 X:74292616-74292638 GACGGGCTCCAGTGGGGCGGGGG - Intergenic
1193819819 X:86148313-86148335 GGCTGCCGCTGGTGAGGAGGTGG - Intergenic
1195093252 X:101483852-101483874 GAGGGGCCCCTGTGTGGAGGAGG - Intronic
1195108105 X:101619555-101619577 GAGGGGCTCCTGTGTGGAGGAGG + Intergenic
1197139563 X:123101864-123101886 GACGGGGGCCTGTCAGCAGGTGG - Intergenic
1198370584 X:135985462-135985484 GGCGGCCGCCGGTGAGGTAGGGG + Exonic
1198462819 X:136879948-136879970 GGCGGGGGCCGGTGAAGAAGAGG - Intronic
1199447701 X:147944985-147945007 GACGGACGGCGGCGTGGAGGGGG + Exonic
1199813487 X:151374746-151374768 GATGGGGCCAGGTGAGGAGGGGG - Intergenic
1200281574 X:154781328-154781350 GAAGGGCGGCGGGGAGGGGGGGG + Intronic
1200786376 Y:7263945-7263967 AAAGGGCGCCGCTGAGCAGGAGG - Intergenic