ID: 1074621463

View in Genome Browser
Species Human (GRCh38)
Location 10:115128311-115128333
Sequence TTTTATATCTAGAAGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074621461_1074621463 -4 Left 1074621461 10:115128292-115128314 CCTGATACTTTATATACATTTTT 0: 1
1: 0
2: 8
3: 139
4: 1207
Right 1074621463 10:115128311-115128333 TTTTATATCTAGAAGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074621463 Original CRISPR TTTTATATCTAGAAGACTGA GGG Intronic
No off target data available for this crispr