ID: 1074632304

View in Genome Browser
Species Human (GRCh38)
Location 10:115272241-115272263
Sequence TACCCTACACCCTGTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074632304_1074632307 3 Left 1074632304 10:115272241-115272263 CCCAACACACAGGGTGTAGGGTA No data
Right 1074632307 10:115272267-115272289 TAATACTGAAAGACGCCATAAGG No data
1074632304_1074632308 4 Left 1074632304 10:115272241-115272263 CCCAACACACAGGGTGTAGGGTA No data
Right 1074632308 10:115272268-115272290 AATACTGAAAGACGCCATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074632304 Original CRISPR TACCCTACACCCTGTGTGTT GGG (reversed) Intronic
No off target data available for this crispr