ID: 1074641639

View in Genome Browser
Species Human (GRCh38)
Location 10:115390621-115390643
Sequence ATGAGCAAGAATAAAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 1, 2: 8, 3: 61, 4: 532}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074641639 Original CRISPR ATGAGCAAGAATAAAACTGA AGG (reversed) Intronic
900072609 1:784999-785021 ATGAGAAAAAACCAAACTGAGGG + Intergenic
901255674 1:7824433-7824455 TTGAAAAAGAATAAAGCTGAAGG - Intronic
904924854 1:34039419-34039441 ATGAGCAAGAAATAAACTTTTGG + Intronic
905520212 1:38593068-38593090 ATGAAAAACAATAAAACTTATGG - Intergenic
906539297 1:46572778-46572800 ATCAAAAGGAATAAAACTGAAGG + Intronic
906644465 1:47463872-47463894 AAGAGCCAGAAAAAAGCTGAAGG + Intergenic
908719544 1:67109606-67109628 ATGAGCATGAATCAAACTGCTGG + Intronic
908840200 1:68272466-68272488 AAGAGTAAGAATAAAATTAAGGG - Intergenic
908983989 1:69994895-69994917 ATCAGCAAGAGTATAATTGAAGG - Intronic
909086671 1:71176383-71176405 AGGAAGAAGAATAAAAATGATGG - Intergenic
909588397 1:77317548-77317570 ATGAGCAAGAAACAAAATGAAGG - Intronic
909921420 1:81385503-81385525 ATGGGAAAGAATAAACCTGAGGG + Intronic
909926390 1:81442453-81442475 ATTGGCAAGAAAACAACTGAAGG + Intronic
910390353 1:86736777-86736799 ATTAGCAATAATATAATTGAGGG - Intronic
910549105 1:88455884-88455906 ATGAGCTAAAGTAGAACTGAGGG - Intergenic
910625749 1:89304610-89304632 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
912018222 1:105069940-105069962 ATAAGCAAGAAGAAATCTGAAGG - Intergenic
912148735 1:106829319-106829341 ATGAGCAAGAACAAAGCTGAAGG + Intergenic
912427027 1:109602998-109603020 AGGAGCACGAACATAACTGAAGG - Exonic
912578541 1:110698829-110698851 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
912859929 1:113204932-113204954 AGCAAAAAGAATAAAACTGAAGG - Intergenic
913132069 1:115849139-115849161 ATAACCAAGAATAAAACTGTTGG + Intergenic
913253590 1:116933796-116933818 AGGAACAGGAATACAACTGATGG - Intronic
913707345 1:121439713-121439735 AGCAAAAAGAATAAAACTGAAGG + Intergenic
915440129 1:155940766-155940788 AGGAGCAGGAACAGAACTGAGGG + Intergenic
916095199 1:161343453-161343475 ATGAAAAAGAACAAAAATGACGG - Intronic
916272505 1:162958350-162958372 ATGAGCAAACATAGAATTGAAGG + Intergenic
916978174 1:170104325-170104347 CTGGGCAAGAACAAATCTGAAGG - Intergenic
917005694 1:170414740-170414762 ATGGGCAAGAATGACAGTGAGGG + Intergenic
917665216 1:177219718-177219740 AAGAGCAAGAGTAACATTGAGGG + Intronic
918018062 1:180657728-180657750 CTGAGCAAAAAGAAAACTGGAGG - Intronic
918259749 1:182785068-182785090 ATTAGCAAGGAGAACACTGAGGG - Intergenic
918475977 1:184925939-184925961 ATGAGCAAGAATAAAGCATTGGG - Intronic
918605863 1:186425018-186425040 ACGAGCAAGAAAGAAATTGATGG + Intergenic
918692063 1:187493555-187493577 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
918774867 1:188614317-188614339 CTGAGCAAGAACACAGCTGAAGG + Intergenic
919175389 1:194012141-194012163 ATGAGCAGATATAACACTGATGG - Intergenic
919211044 1:194486851-194486873 AAGAACAAGAACAAAGCTGAAGG - Intergenic
919335500 1:196225500-196225522 GGGAGCAAGAAGAAAACAGAAGG - Intergenic
920716103 1:208341866-208341888 ATGAGCAAGATTAAAACCTGGGG + Intergenic
921349682 1:214222857-214222879 TGGAGCAAGATTAAAACTCACGG - Intergenic
921427059 1:215015826-215015848 CTGAGCAAACATAAAATTGAGGG + Intronic
921464437 1:215469744-215469766 ATGATGAAGAGTAAAACTGCTGG - Intergenic
922429019 1:225528626-225528648 ATGACCAAGTAGAAAACTGAAGG + Intronic
923364617 1:233247145-233247167 CTGAGCACGAATTAAACAGATGG + Intronic
923580374 1:235205223-235205245 ATAAGAAAGAAAAAAAATGAAGG + Intronic
924033968 1:239916997-239917019 AGAAGCAAGAATTAAAGTGAAGG - Intergenic
924357542 1:243197853-243197875 ATGGGCATGAAGAAAACTGCTGG + Intronic
1064573083 10:16715742-16715764 TTGAGAAAGAACAAAACTGAAGG - Intronic
1064816579 10:19271929-19271951 ATCAGCAAGAAAAACACTGGAGG + Intronic
1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG + Intronic
1065445934 10:25798974-25798996 ATTAGCAATAATAATAATGAGGG + Intergenic
1066784027 10:38982143-38982165 ATGAATAAGAATAAAAGTGGAGG + Intergenic
1066955064 10:42159202-42159224 AAGAGCTAGAATAAAGCTTATGG - Intergenic
1067502707 10:46820188-46820210 AACAGCAAGAATACAAGTGAGGG + Intergenic
1067591882 10:47519826-47519848 AACAGCAAGAATACAAGTGAGGG - Intronic
1067638997 10:48027899-48027921 AACAGCAAGAATACAAGTGAGGG - Intergenic
1067874484 10:49992396-49992418 AACAGCAAGAATACAAGTGAGGG + Intronic
1068281850 10:54882390-54882412 AACAGTAAGAATAAAACTGTGGG - Intronic
1068308235 10:55243252-55243274 ATGAACAAGAGTAGAACTGCAGG + Intronic
1068815799 10:61310652-61310674 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1069292926 10:66805526-66805548 ATAATCAAGAATACAATTGAAGG - Intronic
1069370828 10:67746369-67746391 ATGCACATGAATGAAACTGAGGG + Intergenic
1070135988 10:73694062-73694084 AACAGCAAGAATACAAGTGAGGG - Intronic
1071096025 10:81975863-81975885 ATGAGGAAGAAGAAAACAGATGG + Intronic
1071680303 10:87698097-87698119 ATGACAAAGAAAAAAACAGATGG - Intronic
1071768078 10:88691348-88691370 ATGAGCAATAAGAAATCTGAAGG + Intergenic
1071920652 10:90346243-90346265 AAGAGAAGGAATAAAACTGGGGG + Intergenic
1072121278 10:92407432-92407454 CTGAGTAATAATAAAACTGTAGG - Intergenic
1072126835 10:92453675-92453697 ATGAGGAAAAGTAAAACTCATGG + Exonic
1073921806 10:108467226-108467248 ATGAGAAGGAAGAAAACTGAGGG - Intergenic
1074234154 10:111568051-111568073 ATCATGAAGAATAAAGCTGAGGG + Intergenic
1074641639 10:115390621-115390643 ATGAGCAAGAATAAAACTGAAGG - Intronic
1075204078 10:120431707-120431729 ATGAGAACAAATAAAACTGATGG + Intergenic
1076160458 10:128240453-128240475 ATGAGGAAGAAGCAAAATGATGG + Intergenic
1076263128 10:129087397-129087419 ATGATCAAGAATTCAACTGCTGG - Intergenic
1076800313 10:132819443-132819465 CTGAGCAAGAACAAAGCTGGTGG + Intronic
1079086937 11:17453040-17453062 ATGAGGATGAATAACACTCATGG + Intronic
1079406197 11:20148228-20148250 ATTAGCATCAATAAAGCTGAGGG - Intergenic
1079473365 11:20802021-20802043 CTGAGCAAAAAGAAAACTGGAGG - Intronic
1080006407 11:27412348-27412370 GTGAGCCAGCAGAAAACTGAGGG - Intronic
1080262993 11:30370195-30370217 ACAAGCAAGAATGAATCTGAAGG - Intergenic
1080722581 11:34864458-34864480 AAAAGCAAGAATAAGACTGACGG - Intronic
1080831680 11:35899588-35899610 AGGAGCAATAATAAATCTTAAGG + Intergenic
1081285397 11:41262777-41262799 ATTAGCAAGAATAAAATAGGAGG + Intronic
1081558417 11:44189332-44189354 AAAAACAAGAATAACACTGAAGG - Intronic
1082097393 11:48142285-48142307 TTGAGAAAGAATAAAGCTGGAGG - Intronic
1082194548 11:49286342-49286364 ATCATTAAGAATACAACTGAGGG + Intergenic
1083110083 11:60397620-60397642 ATAATAAAGAATAAAAGTGAAGG + Intronic
1083133086 11:60645466-60645488 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1084931313 11:72558648-72558670 AGGAGAAATAATAAGACTGATGG + Intergenic
1085214124 11:74812872-74812894 ATAAGCTAGAATCACACTGAGGG - Intronic
1085947385 11:81287880-81287902 AAGAGAAAGAATAAAAAAGAGGG + Intergenic
1085954462 11:81374504-81374526 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1086667511 11:89501541-89501563 ATAAGCAAGAATACTACTAAGGG + Intergenic
1086671595 11:89554683-89554705 ATCATTAAGAATACAACTGAGGG - Intergenic
1088244576 11:107804921-107804943 ATGACAAAGAATAAAACCAAAGG + Intronic
1089369620 11:117946133-117946155 AGGCACAAGAATAAAAATGAGGG + Intergenic
1090343533 11:126047440-126047462 ATGAGTAGGATTAAAATTGAAGG - Intronic
1090493047 11:127182677-127182699 ATAAGCAAGTACAAAACTGAGGG - Intergenic
1090574059 11:128081311-128081333 AGCAGAAAGAATAAAGCTGAAGG - Intergenic
1090727921 11:129544229-129544251 AGGAGCAAAAATACAACAGAAGG + Intergenic
1091042116 11:132291382-132291404 ATGAATAAGAGAAAAACTGAAGG + Intronic
1091071872 11:132572688-132572710 CTGAGAAAGAATAAAGCTGGAGG - Intronic
1091202731 11:133794617-133794639 ATAAACCAGAATAAATCTGAGGG + Intergenic
1093013256 12:14130247-14130269 TTGAGGAAAATTAAAACTGAAGG - Intergenic
1093235867 12:16607727-16607749 TAGAGCTAGATTAAAACTGATGG - Intronic
1093392663 12:18641562-18641584 AAGAGAAAGAATAACAATGAAGG - Intronic
1093883324 12:24431042-24431064 ATGAGCAAATATAAAGCAGAAGG + Intergenic
1095262286 12:40110402-40110424 ATGAGGAATAATCAAAATGATGG - Intergenic
1095862639 12:46935079-46935101 ATAAGAAAGTATAAAACTAAGGG - Intergenic
1096930466 12:55202888-55202910 ATCAAAAAGAACAAAACTGAAGG + Intergenic
1096932717 12:55232041-55232063 ATAATCAAGAAAAAAATTGAAGG + Intergenic
1097367919 12:58740832-58740854 TTGAGCAAGAAGAAATCTGGAGG + Intronic
1097764521 12:63510168-63510190 TAGAGCAAGAACAAAACTGGAGG + Intergenic
1097993109 12:65857363-65857385 ACAAGCATTAATAAAACTGAAGG - Exonic
1098413749 12:70209357-70209379 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1098717261 12:73846063-73846085 TTGGGCAAGAATACAAATGAAGG + Intergenic
1098944927 12:76579500-76579522 TTGAGAAAGAACAAAACTGGAGG + Intergenic
1099349299 12:81545307-81545329 ATGATAAAGTAGAAAACTGAAGG - Intronic
1099361147 12:81703385-81703407 TTGAGGAAGAATAAAAATCAAGG - Intronic
1100946780 12:99793390-99793412 AGCAAAAAGAATAAAACTGAAGG + Intronic
1101017351 12:100515513-100515535 ATGGGCACAAACAAAACTGAGGG + Intronic
1101030834 12:100657800-100657822 AGGAGAAAGAAGAAAACAGAAGG - Intergenic
1101228690 12:102716492-102716514 ATAAACAAGAATAAAGCTGGAGG - Intergenic
1101250331 12:102927997-102928019 AATAGAAAGAATAAAGCTGAAGG - Intronic
1101296743 12:103431854-103431876 AGGAGAAAGAATTTAACTGAGGG + Intronic
1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG + Intronic
1101677820 12:106935536-106935558 ATGCTCAAGAATTAAAATGAGGG - Intergenic
1102264757 12:111473916-111473938 ATGAACAAGACAAAAACTAAGGG + Intronic
1104113155 12:125723143-125723165 ATGAGCCAGAATACAACTGATGG - Intergenic
1105255015 13:18738647-18738669 ATGAGCTAGAAAGAAACCGAAGG + Intergenic
1105936799 13:25107868-25107890 ATGAGCTAGAACAAAAGTCATGG + Intergenic
1106736131 13:32589114-32589136 AAGAGCAACAAGAAAACTTAAGG + Intronic
1108130649 13:47296353-47296375 CTGAGCAAAAATAAAGCTGGAGG + Intergenic
1108878780 13:55082966-55082988 AGCAAAAAGAATAAAACTGAAGG - Intergenic
1109409544 13:61944947-61944969 ATTAGCAACAAGAAAACAGAAGG - Intergenic
1109456489 13:62598478-62598500 ATGAGCAAGAACAAAAGAAATGG + Intergenic
1110076454 13:71250529-71250551 AAGAGAAAGAAAAAAAGTGAAGG + Intergenic
1110201582 13:72856782-72856804 TTAAGAAAGAATTAAACTGATGG - Intronic
1111891938 13:94093541-94093563 TTGAGCAAGAACAAAGCTGGAGG - Intronic
1111997424 13:95178617-95178639 ATGAGCAAGCACAAAACCCATGG + Intronic
1112362859 13:98732773-98732795 ATTACCAAGAGTGAAACTGAAGG + Intronic
1112667572 13:101594134-101594156 TTCAGCAAGAACAAAGCTGAAGG + Intronic
1112860610 13:103825704-103825726 CTGAGCAAGAACAAAGCTGGAGG - Intergenic
1114095251 14:19330721-19330743 ATGACCAAGAATAATCCTGTGGG + Intergenic
1114759261 14:25294650-25294672 ATGAGGAATAATAAAAGTTAAGG + Intergenic
1114939878 14:27595478-27595500 ATGAGTGAGTATAAAACTGGTGG + Intergenic
1115228551 14:31132115-31132137 AAGAGCTAGAATAAATGTGACGG - Intronic
1116192977 14:41684000-41684022 AACAGAAAGAATAAAACTGGTGG + Intronic
1116630602 14:47326580-47326602 TTGAGAAGGAATAAAACTGAAGG - Intronic
1117237529 14:53794384-53794406 CAGAGCAGGAATCAAACTGATGG + Intergenic
1117627907 14:57659101-57659123 CTGAGAAAGTAGAAAACTGAAGG - Intronic
1117849646 14:59954099-59954121 AGGAAGAAGAATAAAGCTGAAGG - Intronic
1119152762 14:72378364-72378386 ATGAACAATATTGAAACTGAAGG + Intronic
1119153099 14:72383699-72383721 TTGAGAAAGAGTAAAACAGAAGG - Intronic
1120122686 14:80701056-80701078 ATTAGCCAGGGTAAAACTGAAGG + Intronic
1120221561 14:81740143-81740165 ATGATCAATCATAAAACAGATGG + Intergenic
1120373705 14:83672366-83672388 AATAGCAAGATTAAGACTGATGG + Intergenic
1120390820 14:83905751-83905773 ATAAAAAAAAATAAAACTGAAGG - Intergenic
1120549963 14:85858325-85858347 ATAGCCAAGAATAAAACTCATGG - Intergenic
1120725704 14:87937823-87937845 GTTTGCAAAAATAAAACTGAAGG + Intronic
1121373687 14:93385116-93385138 CTAAGCAAAAACAAAACTGAAGG - Intronic
1122121323 14:99555011-99555033 ATGAGCAAGAACAGACTTGAAGG + Intronic
1122244735 14:100394519-100394541 AAGAGCCAGAATTTAACTGATGG - Intronic
1122832938 14:104411443-104411465 ATCATGAAGAACAAAACTGAAGG + Intergenic
1123181782 14:106478109-106478131 ATAAGCAAGAGGAAAATTGATGG + Intergenic
1123206699 14:106720401-106720423 ATAAGCAAGAAGAAAATTGATGG + Intergenic
1123211721 14:106767405-106767427 ATAAGCAAGAAGAAAATTGATGG + Intergenic
1202938675 14_KI270725v1_random:120163-120185 AAGAGCTAGAATAAAACATATGG - Intergenic
1202945122 14_KI270726v1_random:18619-18641 ATAAGCAAGAGGAAAATTGATGG - Intergenic
1123768614 15:23506860-23506882 ATGAGATAAAATAAAGCTGAAGG - Intergenic
1124036188 15:26055287-26055309 TTCAGCAAGAAGAAAACGGATGG + Intergenic
1124151145 15:27179413-27179435 ATAAGCAATTACAAAACTGAGGG - Intronic
1124663664 15:31571987-31572009 AAGAGCAAGAAGAAAAATTAGGG - Intronic
1125959947 15:43821424-43821446 CTGAAGAAGAATAAAGCTGATGG + Intronic
1127615576 15:60682314-60682336 ATGAGTCAGTATGAAACTGAGGG - Intronic
1129422912 15:75443749-75443771 AAAAGCAATAAGAAAACTGAAGG + Intronic
1129961485 15:79690749-79690771 TTGAGAAAGAATAACACTGTAGG + Intergenic
1130295462 15:82644790-82644812 AAGACTAAGAATAAAACTAATGG + Intronic
1130559691 15:84948178-84948200 ATGAGCTTGAATTAAATTGAGGG - Intergenic
1131592322 15:93762903-93762925 CTGAGCAAGAACAAATGTGATGG - Intergenic
1133509633 16:6444952-6444974 TTGAGGGAGAGTAAAACTGATGG + Intronic
1133753483 16:8743878-8743900 AAGATCAAGAGTAACACTGAAGG + Intronic
1133881149 16:9783666-9783688 AAGAGAATGAATAAAACTCAGGG + Intronic
1135684300 16:24485940-24485962 ATGAGCTAGAAGATGACTGAAGG - Intergenic
1137783663 16:51119433-51119455 AAGTGCAAGAATAAAAGAGATGG - Intergenic
1138258223 16:55589238-55589260 ATGAGCATGTAAAATACTGAGGG + Intergenic
1138806430 16:60094915-60094937 AGGAAAAAGAATAAAACTGGAGG - Intergenic
1138868932 16:60857204-60857226 ATGTGCAAGAAGGAAACTGCAGG + Intergenic
1139070775 16:63379531-63379553 ATGAACCAGAATAGAAGTGAAGG + Intergenic
1140119414 16:72070693-72070715 CTGAACAAGCATCAAACTGAAGG - Intronic
1141765773 16:86059355-86059377 ATGAGCAAAGATGAAACTGGAGG - Intergenic
1142788594 17:2245082-2245104 AGGAGCAAGGATAATAGTGAAGG + Intronic
1143144659 17:4766928-4766950 AAGAACAAGAATAGAACTGGTGG - Intergenic
1143237250 17:5413411-5413433 ATTACGAAAAATAAAACTGAAGG + Intronic
1143327536 17:6109315-6109337 ATGAGCAGCAATATGACTGAGGG - Intronic
1143694951 17:8607021-8607043 ATGAGGAACAATAAAAATAAAGG + Intronic
1143811366 17:9474367-9474389 AAAAGAAAGAAAAAAACTGAGGG - Intronic
1144159587 17:12544495-12544517 ATGCTCAAAAATCAAACTGATGG - Intergenic
1144683242 17:17209103-17209125 ATAAACAAAAATAAAACTGGGGG + Intronic
1145027272 17:19477500-19477522 AAGAGCAAGAAGAAAATAGAAGG - Intergenic
1145179156 17:20729956-20729978 ATGAGCATCAATAAAAATAACGG - Intergenic
1145706765 17:26878330-26878352 ATGGGAAGGAATGAAACTGAAGG + Intergenic
1146672523 17:34751440-34751462 CTGAGCTAGATTAGAACTGAGGG - Intergenic
1147269903 17:39261780-39261802 TTGTGTAATAATAAAACTGAGGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149047260 17:52261481-52261503 ATGAAAAAGAACAAATCTGAAGG - Intergenic
1150201722 17:63363788-63363810 CTAAGCAAGAACAAAACTGGAGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151002168 17:70390111-70390133 ATGAGAAAAAATTAAACTAAAGG + Intergenic
1151029297 17:70717582-70717604 ATGAAGAAGAAAAAAAATGATGG - Intergenic
1203173123 17_GL000205v2_random:169801-169823 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1153856695 18:9155620-9155642 CTGACCAAGATTAAAACTGTTGG - Intronic
1154436011 18:14341959-14341981 ATGAGCTAGAAAGAAACCGAAGG - Intergenic
1155114841 18:22753940-22753962 ATGATCAAGAATAAAAGGAATGG + Intergenic
1155330131 18:24707308-24707330 AAGAGGTAGAATAAAACTGCTGG + Intergenic
1155532437 18:26780808-26780830 ATGATAGAGAATAAAAGTGAGGG - Intergenic
1155859219 18:30875912-30875934 ATGAGCAAAGATAAAATTGGTGG + Intergenic
1157227419 18:45879879-45879901 ATGGGCAAGAATTAGACTCAGGG + Intronic
1157680997 18:49606362-49606384 AAAAGGAAGAATAAAATTGAAGG + Intergenic
1158035084 18:53018782-53018804 ATGAGCATCTCTAAAACTGAAGG - Intronic
1158423409 18:57315956-57315978 TTGATCAAGAACAAAACTGAAGG - Intergenic
1158837544 18:61347009-61347031 AAGAGCAAAAATAGAACCGATGG - Intronic
1158897659 18:61930137-61930159 ATGAGCAGCAAAAAAGCTGATGG + Intergenic
1159855009 18:73575998-73576020 ATGAAGAAGAATAAAACTAGAGG - Intergenic
1162059989 19:8088779-8088801 ATGAGCAAGGAGACAAATGAAGG + Intronic
1162613671 19:11777566-11777588 AGGAGGAATATTAAAACTGAAGG - Intronic
1164005864 19:21148550-21148572 ATTAGATAGAATAAAACTGAAGG - Intronic
1164101068 19:22054806-22054828 AAGACCAAGAACAAAACTAAAGG - Intronic
1164134686 19:22403745-22403767 ATGATGAAGTATAAAACTGAGGG + Intronic
1164164128 19:22653050-22653072 ATGATGAAGTATAAAATTGAGGG - Intronic
1164285089 19:23807569-23807591 ATGATAAAGTATAAAATTGAGGG - Intronic
1164406863 19:27956912-27956934 AACAGCAAGAATATAAATGAGGG + Intergenic
1167696465 19:51018362-51018384 AAGAGGAAGAAAAAAAGTGAGGG + Intronic
926554360 2:14340403-14340425 TTGAGCAAGAACAAAACTAGAGG + Intergenic
926809918 2:16746757-16746779 ATTAGCAAGAGAAAAACTTAAGG - Intergenic
926894924 2:17675714-17675736 AAGAGCAACAATAAAACCAAAGG - Intronic
926898602 2:17723561-17723583 ATGCCTAAGAAGAAAACTGAAGG - Intronic
927289163 2:21388116-21388138 ATGAGAAGGAATAAAACTTCAGG + Intergenic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
928831749 2:35494186-35494208 ATAAGTAAAAATAAAACTCAAGG + Intergenic
928891343 2:36206808-36206830 ATGAACAAGAATAATACTCGAGG - Intergenic
929081825 2:38129035-38129057 ATCAGCAAAATTAAAAGTGAAGG - Intergenic
929331555 2:40688021-40688043 AGGAGCAAGAAGAGAACAGATGG - Intergenic
929654496 2:43717068-43717090 ATAAGCTAGAATAAAATGGAAGG + Intronic
929763779 2:44827571-44827593 TAGAGAAAGAATAAAACGGAAGG - Intergenic
930288611 2:49465943-49465965 ATGAGCAATAAGAAATCTGAAGG - Intergenic
932395324 2:71442111-71442133 AAAAAGAAGAATAAAACTGAAGG + Intergenic
934622727 2:95825297-95825319 ATAAAAAAGAATAAAACGGAAGG - Intergenic
934811051 2:97276806-97276828 ATAAAAAAGAATAAAACGGAAGG + Intergenic
934826641 2:97431133-97431155 ATAAAAAAGAATAAAACGGAAGG - Intergenic
934982988 2:98862070-98862092 ATGAGAAACAAGAAAAGTGAAGG - Intronic
935049946 2:99516974-99516996 ATGCCCAAGAATATAACTGCTGG + Intergenic
935078379 2:99768599-99768621 ATGAGCCAGAAATCAACTGAAGG - Intronic
935153817 2:100464494-100464516 ATGTGTAAGAATATAACAGAGGG + Intergenic
935813170 2:106819646-106819668 ATGAGCAATAAGAAATCTGAAGG + Intronic
935894253 2:107717056-107717078 ATGAGAAAAAAGAAACCTGAAGG - Intergenic
935952236 2:108340723-108340745 ATGAAAAAGAACAAAGCTGAAGG - Intergenic
936706499 2:115080976-115080998 AGGAGCAAGAATTTGACTGATGG - Intronic
936835863 2:116708564-116708586 AGGAGGAAGAGTAAAGCTGAAGG - Intergenic
937137983 2:119571798-119571820 ATGAGAAAGCACAAAGCTGATGG + Intronic
937739876 2:125338561-125338583 AGCAGAAAGAACAAAACTGAAGG + Intergenic
937759155 2:125579235-125579257 ATGAGTGAGAATAAACATGATGG + Intergenic
937814100 2:126231987-126232009 TTGAGCAAGAAAGAAACGGAGGG - Intergenic
938198298 2:129352259-129352281 ATGAGCAAGAATAAAATTGGAGG + Intergenic
938484409 2:131689399-131689421 ATGACCAAGAATAATCCTGTGGG - Intergenic
938812327 2:134864855-134864877 AGGAGGAAGAAGAAGACTGATGG - Intronic
939356813 2:141113353-141113375 ATAAGCAATAAAAAAAATGAGGG + Intronic
939446884 2:142321683-142321705 AGGATCAAGAATTCAACTGAGGG - Intergenic
939572629 2:143858429-143858451 ATGAACAAGATAAAATCTGAGGG - Intergenic
939573577 2:143869140-143869162 ATGAGCAAAAAGAAAACCCAAGG - Intergenic
940753272 2:157652401-157652423 TTGAGCAAGATTTAAACTTATGG - Intergenic
940889241 2:159018876-159018898 AAAAGAAAGAATAAAACTCAAGG + Intronic
942291209 2:174473120-174473142 TCGATCAAGAATAAAATTGAAGG + Exonic
943042860 2:182823924-182823946 ATTAGCGGGAATAAAAGTGAAGG - Intergenic
943173929 2:184443895-184443917 AGGAGCAAGGATAAATATGAAGG + Intergenic
943195058 2:184736101-184736123 ATGTGTTAGAATGAAACTGAGGG - Intronic
943277614 2:185888144-185888166 AAAAACAAGAGTAAAACTGAAGG + Intergenic
943281320 2:185937376-185937398 ATGCGGAAGAATAAAACTGATGG - Intergenic
943687835 2:190837805-190837827 AGGAGGAAGAAAAAAAATGAGGG + Intergenic
943964490 2:194315508-194315530 TTGAGAAAGAATAAAGGTGAAGG - Intergenic
943976223 2:194482092-194482114 ATAAGCAAGATTGAATCTGAAGG + Intergenic
944325667 2:198400756-198400778 AATAGCAAGTAGAAAACTGAGGG - Intronic
945232755 2:207609709-207609731 TTGAGCAAGGGTAAAACAGAAGG + Exonic
946636407 2:221732732-221732754 ACTGCCAAGAATAAAACTGAAGG + Intergenic
946960611 2:224981544-224981566 ATCAGCAAGAATAAATTTGAGGG - Intronic
947027310 2:225750907-225750929 GGGAGCAAGAATAAAATTAAGGG - Intergenic
947158014 2:227183321-227183343 ATGAGTTAGAATAAAACTAAGGG + Intronic
948564668 2:238876293-238876315 ATTAGGAAGAATAAAACTTAGGG + Intronic
1168751763 20:287174-287196 ATGCCCAAGAGTAAAACTGCTGG + Intronic
1168863788 20:1066214-1066236 AAGAGCAACAATAAGACTGATGG - Intergenic
1169304268 20:4474765-4474787 ATGAGAAAGAATAAAAGGAAAGG - Intergenic
1169310065 20:4529769-4529791 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
1169821221 20:9712571-9712593 AGCAGAAAGAATAAAACTGGAGG + Intronic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1169980036 20:11374293-11374315 TTAAGCAAGAATAAAACCAATGG + Intergenic
1169990174 20:11493795-11493817 ATGAGCAAGAGAAAGACAGAGGG + Intergenic
1170014001 20:11760191-11760213 CTGAGAAAGAACAAAGCTGAAGG - Intergenic
1170748945 20:19127149-19127171 TTGAGCAAGAACAAAACTGAAGG - Intergenic
1171153620 20:22850720-22850742 ATGAGCAAGAATGAAGCTGAAGG + Intergenic
1171516048 20:25737238-25737260 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1173045845 20:39510848-39510870 ATGAAGTAGAATAAAACTGTAGG + Intergenic
1174808323 20:53624137-53624159 ATGGGCAAAAATAAAAGTGCTGG - Intergenic
1174876841 20:54235659-54235681 AAAAGCAAGAATCAAAATGATGG - Intergenic
1175769655 20:61615750-61615772 ATCAGCATGTATAAAAGTGAGGG + Intronic
1176329106 21:5531443-5531465 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176398651 21:6289508-6289530 ATGAGCAAGAACCAAACTCTTGG - Intergenic
1176438506 21:6699596-6699618 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176462768 21:7026666-7026688 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176486329 21:7408444-7408466 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176584638 21:8568970-8568992 AAGAGCTAGAATAAAACATATGG + Intergenic
1176841026 21:13843676-13843698 ATGAGCTAGAAAGAAACTGAAGG + Intergenic
1177174726 21:17691234-17691256 ATGAGTAAGAAGAAAACTCCTGG - Intergenic
1177492401 21:21844709-21844731 AGTAGAAAGAATAAATCTGAGGG - Intergenic
1177538777 21:22464507-22464529 AGGAGAAAGAATAAAGCTGGAGG - Intergenic
1177820768 21:26028827-26028849 ATGAGCAAGAAAAAAAATTATGG + Intronic
1177880114 21:26683747-26683769 ATGAACAAGGATTAAAGTGAGGG - Intergenic
1178212214 21:30548715-30548737 CTGAGCAAGAACAAAGCTGGAGG - Intronic
1178475070 21:32930960-32930982 ACGAGCAAGAAGAAACCTGGAGG + Intergenic
1178896861 21:36566031-36566053 ATGATAAAAAATAAGACTGATGG - Intronic
1178997020 21:37411827-37411849 ATGTGCAGGAAAAAAACTGGTGG - Intronic
1180267449 22:10545872-10545894 AAGAGCTAGAATAAAACATATGG + Intergenic
1181016922 22:20075789-20075811 ATGAGAAAGAAAAAAAATGTAGG - Intergenic
1181642523 22:24210875-24210897 AAAAGCAAAAACAAAACTGAAGG + Intergenic
1181914252 22:26266630-26266652 AGGAGCAAGAATAAAAACCAAGG + Intronic
1182026851 22:27126219-27126241 ATGTGCAAGTATCACACTGAGGG + Intergenic
1182180514 22:28342437-28342459 ATAAGCAAAAATGAAAGTGATGG - Intronic
1182458196 22:30465983-30466005 ATGAGCACAAATAAAACAGCTGG + Intronic
1182610943 22:31546992-31547014 ATGTGCATCAGTAAAACTGAAGG - Intronic
1184199626 22:42958601-42958623 AAGAGCAAAGACAAAACTGATGG + Intronic
1184966868 22:47982284-47982306 AAGAGCAATAATAAAAAAGATGG - Intergenic
1185368855 22:50449743-50449765 AAGAGCAACAATAAAACTGACGG + Intronic
951106955 3:18755688-18755710 ATGTGCAGGAATAAAACAAAAGG + Intergenic
951326584 3:21309492-21309514 AATAACAAGAATAAACCTGAAGG + Intergenic
951716735 3:25656892-25656914 TTAAGCTAGAATAAAACTGAAGG + Intronic
952132255 3:30378334-30378356 AGGAGAAAGAATAAAACTAGAGG - Intergenic
952604848 3:35133131-35133153 ATGAACTAGAAGAAAAGTGAGGG + Intergenic
952674091 3:36006038-36006060 AAGAAGAAGAAGAAAACTGAAGG + Intergenic
952765294 3:36947916-36947938 CTGATCATGCATAAAACTGAGGG - Intergenic
953011945 3:39035149-39035171 AGCAGAAAGAACAAAACTGAAGG + Intergenic
953043273 3:39273621-39273643 TTCAGCAAGAATCAAACAGAAGG + Intronic
953740493 3:45534503-45534525 AGATGCAGGAATAAAACTGAAGG - Intronic
953807198 3:46080842-46080864 ATCAGCAAGAATAAACAAGAGGG - Intergenic
954102490 3:48386430-48386452 TTGAGAAAGAATAAAGCTGGAGG - Intronic
955503869 3:59611882-59611904 ATGATCAGGAAAAAAACTGTGGG - Intergenic
956851865 3:73235872-73235894 ATGAGCAAGAGCAAAAGAGATGG - Intergenic
957021266 3:75130429-75130451 ATGAGAAAGCACAAAAATGAAGG + Intergenic
958100354 3:89000654-89000676 ATGAGCAAATAAATAACTGAAGG + Intergenic
958674531 3:97251228-97251250 ATGTGTAAGAATAAAACAAAAGG + Intronic
958738755 3:98042456-98042478 CTGAGCAAGAACAAAGCTGGAGG + Intergenic
959269142 3:104183474-104183496 AGGAGTGAGAAAAAAACTGAAGG + Intergenic
961586001 3:127925366-127925388 AAGAGCAAGTGTAAAACTGGTGG - Intronic
962099134 3:132323511-132323533 TTGAGCAAGAATTATAATGATGG + Intronic
963411527 3:144933396-144933418 GTGAGCAATAAGAAATCTGATGG + Intergenic
963516386 3:146314981-146315003 TTTAGCAAGAAAACAACTGAAGG - Intergenic
964429977 3:156595108-156595130 AGAAGCAGGAATGAAACTGATGG - Intergenic
964440751 3:156706735-156706757 CTAAGCAAAAATAAAACTTATGG + Exonic
964758593 3:160111956-160111978 ATGAGAAAAAAAAAAACTGATGG + Intergenic
964998265 3:162916499-162916521 CTGAGCAAAAATAAAGCTGAAGG - Intergenic
965035127 3:163427947-163427969 ATGAGCAAGAAATCATCTGAAGG + Intergenic
965041668 3:163516945-163516967 AGTAGCAAAAATAAAAGTGAGGG - Intergenic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
965603181 3:170474499-170474521 ACGAGCAAGAATAATCCTGAAGG - Intronic
965890565 3:173508701-173508723 ATGAGCAGGACAAAAACTCAAGG - Intronic
966258078 3:177942337-177942359 ATAACCAAGAATGAAACTGTTGG - Intergenic
966266414 3:178049935-178049957 AACAGCAACAAAAAAACTGAAGG - Intergenic
966820858 3:183923207-183923229 ATTAGCAAGAAAAAAATTAAGGG + Intronic
967855112 3:194111484-194111506 ATGAGGAAGAAGAAAGCTCAAGG - Intergenic
968004471 3:195230818-195230840 AGCAGAAAGAATAAAACTGGAGG - Intronic
968786678 4:2627124-2627146 ATAAGGAAGAATAAAAATTATGG - Intronic
969949605 4:10821491-10821513 AAAAGAAAAAATAAAACTGATGG - Intergenic
970379049 4:15488162-15488184 ATGAGCAATAAGAAATCTGAAGG - Intronic
970808185 4:20060568-20060590 ATGATGAATAATAAAAATGAAGG - Intergenic
970935548 4:21566011-21566033 ATGAGCAAGCAAAGAACTGTAGG + Intronic
970981016 4:22097217-22097239 ATTTTCAACAATAAAACTGAGGG - Intergenic
971119332 4:23686705-23686727 ATGAGAAAGAAAAAGACAGATGG - Intergenic
972443870 4:39124369-39124391 TTGAACAAGAATAAAGTTGAAGG + Intronic
972945769 4:44253556-44253578 AAGAGCAAGAATATAAGAGACGG - Intronic
973224674 4:47769573-47769595 TTGAGCGAAAAGAAAACTGAAGG + Intronic
974291035 4:59931172-59931194 AGCAACAAGAAGAAAACTGAAGG + Intergenic
974396687 4:61345561-61345583 ATGGGCAAGAATAAAAACTATGG + Intronic
974819556 4:67048576-67048598 ATAAGCAAGGAAAAAAGTGAAGG - Intergenic
975833431 4:78394645-78394667 TTGAGCAAGAACAAAGCTGGTGG - Intronic
976028191 4:80717288-80717310 ATGTGTAAGCAGAAAACTGAAGG + Intronic
976910586 4:90300662-90300684 ATGAGAAAGAAGAAAAGCGAAGG + Intronic
976934462 4:90612393-90612415 ATGAGAAAGGCTAAAACTGATGG - Intronic
976999200 4:91474903-91474925 ATACACAAGGATAAAACTGAAGG - Intronic
977301945 4:95277923-95277945 AAGAACAATAATAAAATTGATGG + Intronic
977522399 4:98101417-98101439 ATGGGCAAGTAGAAAACTTAGGG - Intronic
977873197 4:102118276-102118298 TTGAGCAAAAATAAAAATAATGG - Intergenic
977961066 4:103086241-103086263 ATTAGAAAGAATAAAAGGGAGGG + Intronic
977981067 4:103322593-103322615 ACAAGAAAGAATAAAAATGAAGG - Intergenic
978126472 4:105141900-105141922 ATAAGCAGGAAAAAAACAGAAGG + Intergenic
978288342 4:107106200-107106222 AAAAGCAAGAAAAAAAATGAAGG + Intronic
978554129 4:109960141-109960163 TTCAGCCAGAATAAAACTGCTGG + Intronic
979244267 4:118481627-118481649 ATGGGCATGAAGAAAACTGCTGG - Intergenic
979430663 4:120625621-120625643 TTGAGCAAGAACAAATCTGGAGG + Intergenic
980311746 4:131140133-131140155 TTCAGCAAGAAAAAAACAGAAGG + Intergenic
980337776 4:131499008-131499030 GTGAGCAAAAATAAAGCTGAAGG + Intergenic
980814723 4:137929630-137929652 CTGAGACAGAATAAAACTAAAGG + Intergenic
981266539 4:142790626-142790648 AGGAGAAAGAAACAAACTGAAGG + Intronic
981771128 4:148309945-148309967 ATGAGCAAACAAAAAAATGAAGG + Intronic
982473638 4:155824530-155824552 GTCAGCAAGAAAAAAAATGAGGG + Intergenic
982614755 4:157626600-157626622 ATGAGCCAGAAAAAAAGTGGTGG - Intergenic
982681565 4:158437204-158437226 ATGAGCAAAAATAAGGCTGGAGG + Intronic
982949583 4:161674303-161674325 ATGGGAAAGAATAGAAATGAGGG + Intronic
983058964 4:163133076-163133098 TTTATCAATAATAAAACTGAAGG - Intronic
984306063 4:177992945-177992967 ATGAGCAAAAATAAAATTAGAGG - Intergenic
984411124 4:179399292-179399314 ATGAGCAAGAAGTAACCTGATGG - Intergenic
984756635 4:183331074-183331096 AAGAGAAAGAATGAAAGTGATGG - Intergenic
985059577 4:186063471-186063493 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
985376083 4:189340052-189340074 AAGAGCGAGAATCAAACTGGAGG + Intergenic
987561852 5:19534155-19534177 ATGAGCAATAATAAAAATATAGG + Intronic
988261911 5:28897763-28897785 AAGTACAAGAATAAAATTGATGG + Intergenic
988678721 5:33461979-33462001 ATAAGTAAGATTAAATCTGATGG - Exonic
988912239 5:35855021-35855043 CGGAGCAAGAATCCAACTGAAGG - Intronic
989310404 5:40010524-40010546 ATGAGCTAGAATAAAGAGGATGG - Intergenic
989356658 5:40551259-40551281 AGGCCCAAGAATAAAACTAAGGG + Intergenic
989703964 5:44305584-44305606 ATGGGAAAAAATAGAACTGAAGG + Intronic
990433653 5:55765146-55765168 ATGGAAAAGAATAAAAATGATGG - Intronic
990942478 5:61216601-61216623 ATGATAAAGAAAAAAAATGATGG - Intergenic
991311647 5:65249620-65249642 AGAAGAAAGAATACAACTGAGGG - Intronic
993139108 5:84007975-84007997 ATTAGCATGGATAAAACTGGAGG + Intronic
993400550 5:87445011-87445033 ATGAGCAAGAAGAAATGTCAAGG + Intergenic
994217644 5:97157225-97157247 ATGAGCAATAAGAAATCTGAAGG - Intronic
995140833 5:108733234-108733256 ATACGAAAGAGTAAAACTGAGGG + Intergenic
996259509 5:121448142-121448164 ATGAGCAAGAAGTCATCTGAAGG + Intergenic
996493409 5:124125720-124125742 AGGTGTAAGTATAAAACTGATGG + Intergenic
997080238 5:130730020-130730042 ATGAGCAACTATATAACAGATGG + Intergenic
997101420 5:130973294-130973316 GTGAAAAAGAATAAAACTAATGG - Intergenic
997277184 5:132604565-132604587 ATGAGAAAGAATACAGCTCATGG - Intronic
998759623 5:145418440-145418462 CTAAGCAAAAATAAAACTGGAGG + Intergenic
1000035314 5:157443290-157443312 ATTAGCCAGAATAAAACCCAGGG + Intronic
1000126852 5:158253923-158253945 AGGAGCAATAATAGAGCTGAAGG - Intergenic
1000497409 5:162002167-162002189 AAAAACAAGACTAAAACTGATGG + Intergenic
1000716568 5:164651690-164651712 ATGAGTAAGAATAAAATTCATGG - Intergenic
1001342492 5:170860957-170860979 AGGAGCAACAATTAGACTGATGG + Intergenic
1001552534 5:172614127-172614149 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
1002920360 6:1565279-1565301 AGGAGCAGCAATAAAACTGATGG + Intergenic
1005235087 6:23751205-23751227 CTGAGCAAGAACAAAGCTGGAGG - Intergenic
1005530137 6:26695927-26695949 TTGAGCAAAAACAAAACTGGAGG + Intergenic
1005540659 6:26805720-26805742 TTGAGCAAAAACAAAACTGGAGG - Intergenic
1005757024 6:28934078-28934100 ATGAGAAAGAATAACACAGTGGG + Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006015815 6:31079701-31079723 ATGAGCAAGCAGGAAACTGGGGG + Intergenic
1008232821 6:49005215-49005237 ATGAGATAGAATCAAAATGAAGG - Intergenic
1008459751 6:51754449-51754471 CTAAGCCAGAATAAAACTTATGG - Intronic
1008939614 6:57032034-57032056 AGGAGAAAGAATTCAACTGAAGG + Intergenic
1008939865 6:57035117-57035139 ATGAGCAAGCAGAAAACCCATGG - Intergenic
1008956245 6:57219523-57219545 TTGAAAAAGAATAAAACTGGAGG + Intronic
1009011472 6:57847815-57847837 TTGAGCAAAAACAAAACTGGAGG - Intergenic
1009692734 6:67057507-67057529 TTGAATAAGAATAAAACTGGAGG - Intergenic
1009846665 6:69143820-69143842 AGCAGAAAGAATAAAACTGGAGG - Intronic
1011385084 6:86787655-86787677 AGAAGCAAGAATAAAACTGGAGG - Intergenic
1011716008 6:90105755-90105777 ATGAACAAGAAGAAAAGTGAAGG + Intronic
1011982303 6:93395911-93395933 GTTAGCACCAATAAAACTGAAGG - Intronic
1012082054 6:94771883-94771905 ACGAGAATGAATAAAAGTGAAGG + Intergenic
1012659704 6:101872602-101872624 AGGTGAAAGAATAAAACTGATGG - Intronic
1012722429 6:102762694-102762716 ATGAGGAACAATAAAACTGCAGG + Intergenic
1012769540 6:103413000-103413022 TTAAGAAAGAATAAAACTGTTGG - Intergenic
1013728422 6:113130765-113130787 ATGAGAAAAAGTAAAACTGGAGG - Intergenic
1013857776 6:114594923-114594945 TGGAGCAAGAATAAAAATGAAGG - Intergenic
1014966536 6:127760322-127760344 TTGAGAAAGAATAAAGCTGGAGG - Intronic
1015002803 6:128240265-128240287 ATCAGAAAGAAGAAAACTGAGGG + Intronic
1015017522 6:128431990-128432012 AAGAGGAAGAAAAAAAGTGAGGG + Intronic
1015280845 6:131432436-131432458 AGGAGCATGAATAAAACTCATGG - Intergenic
1015426576 6:133076926-133076948 ATGAGCAAGAAACAGATTGATGG + Intergenic
1015994101 6:138980282-138980304 ATGAGCAAAAAGAATACTGGGGG - Intronic
1017462966 6:154668427-154668449 AAGAAGAAGAAGAAAACTGAGGG + Intergenic
1020053466 7:5099488-5099510 GTGAGCAAGAACGAAGCTGAAGG - Intergenic
1020597220 7:10223061-10223083 TTGAGAAAGAAAAAAACTTATGG + Intergenic
1020666999 7:11058101-11058123 TTTAGCAACAATAAAACTGTAGG - Intronic
1020738293 7:11980796-11980818 ATCAAAAAGAATAAAGCTGAAGG + Intergenic
1020824001 7:13004263-13004285 ATGCAAAAGAATGAAACTGAAGG - Intergenic
1020824018 7:13004498-13004520 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1020839799 7:13201845-13201867 ATCAGAAAAAAAAAAACTGATGG + Intergenic
1020998789 7:15300714-15300736 ATGAGAAAGAGTAAAACTCCTGG + Intronic
1021200311 7:17721764-17721786 ATGAGTAAGAATCAATTTGAGGG + Intergenic
1022545939 7:31189102-31189124 TTGAGAAAGAAGAAAACTGCTGG - Intergenic
1022676169 7:32501336-32501358 ACAAGAAAGAAGAAAACTGAAGG + Intronic
1023610681 7:41967510-41967532 ACTAGCAAACATAAAACTGAGGG + Intronic
1023788403 7:43731462-43731484 ATCACAAGGAATAAAACTGATGG + Intergenic
1024151674 7:46578067-46578089 GTGACCAAGATGAAAACTGAAGG + Intergenic
1024429106 7:49264953-49264975 ACGAGCAAGAATCAAACTCACGG + Intergenic
1025791941 7:64696735-64696757 ATAAGCTAGTAAAAAACTGATGG - Intronic
1026017159 7:66680644-66680666 ATGAGCAAGAACAGAAATTAGGG + Intronic
1026326138 7:69312406-69312428 AATAGGAAGAATTAAACTGATGG - Intergenic
1028120027 7:87046889-87046911 AGCAGAAAGAACAAAACTGAAGG + Intronic
1028209660 7:88058075-88058097 ACTAACAAGAATAAAACAGATGG + Intronic
1028361131 7:89967383-89967405 ATGAGCTAAAGTAAAACTTAGGG + Intergenic
1029960582 7:104685869-104685891 ATGAGGAAGAATCAAAGTAATGG + Intronic
1030134602 7:106234789-106234811 AGAAGAAAGAATTAAACTGAGGG + Intergenic
1030148589 7:106380535-106380557 ATGGGCAAGAGAAAAACTGGAGG + Intergenic
1030209660 7:106983604-106983626 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1030279979 7:107763689-107763711 ATGAACAAGAATATAAAAGAGGG - Intergenic
1030768050 7:113436761-113436783 ACCAGAAAGAATAAAACTGGAGG - Intergenic
1031313099 7:120223909-120223931 ATAAGAAAGAATAAAAATAAAGG - Intergenic
1031894537 7:127333775-127333797 AGCAACAAGAATAAAGCTGAAGG + Intergenic
1032314719 7:130825166-130825188 TTGAGCAAGGACAAAACTGGAGG - Intergenic
1032565268 7:132935232-132935254 ATGAGCAAAAGTAAAACTAGTGG + Intronic
1032991261 7:137397034-137397056 TTGAGAAAGAATAAATGTGATGG + Intronic
1033119794 7:138657589-138657611 AAGAGCAATTAGAAAACTGATGG - Intronic
1033177990 7:139144348-139144370 AGGAGCAACAATTAGACTGATGG - Intronic
1033392847 7:140944341-140944363 AATAGCAAGAAAAAAAGTGAGGG - Intergenic
1033498998 7:141928829-141928851 AAGACCATGTATAAAACTGATGG - Exonic
1033632018 7:143167883-143167905 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
1033640527 7:143259664-143259686 CTGATGAATAATAAAACTGATGG + Intronic
1034731883 7:153394292-153394314 GTTAGAAAGCATAAAACTGAAGG + Intergenic
1035091097 7:156311443-156311465 TTGAGCAAGAACAAAACTGAAGG - Intergenic
1035138778 7:156736089-156736111 ATGAGGAAGAATAAAAGTCTAGG + Intronic
1035164348 7:156976225-156976247 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
1035788674 8:2283786-2283808 ATTAGCAAGAATTAAAGGGAGGG + Intergenic
1035804131 8:2437919-2437941 ATTAGCAAGAATTAAAGGGAGGG - Intergenic
1035866222 8:3085417-3085439 ATTGCCAAGAATAAATCTGAAGG + Intronic
1036547888 8:9789771-9789793 TTGAGAAAGAATAAAAATAAAGG + Intergenic
1037288224 8:17323406-17323428 ATGAACAGGAACCAAACTGAAGG + Intronic
1037423244 8:18726565-18726587 ATGAGCATGAATTAAAGTCATGG - Intronic
1038079194 8:24113770-24113792 AAGAACAACAATAAAACAGAAGG - Intergenic
1039232931 8:35468880-35468902 GTGAGTTAGAAGAAAACTGAGGG + Intronic
1039255044 8:35709719-35709741 ATGTTTAAGAATAGAACTGAGGG + Intronic
1040692875 8:49961060-49961082 TTGGGCAAGAATAAAACATATGG + Intronic
1040761989 8:50858416-50858438 TTGAGAAAGAATAAAGCTGGAGG - Intergenic
1042196351 8:66233773-66233795 ATGACTAAGAGCAAAACTGAAGG + Intergenic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1043033204 8:75164844-75164866 ATGAGGAAGAAGAAAAAAGATGG + Intergenic
1044175535 8:89116276-89116298 TTGAGTAACAACAAAACTGAGGG + Intergenic
1045896705 8:107226993-107227015 AAGGGGAAGAAAAAAACTGAGGG - Intergenic
1046465782 8:114601430-114601452 ATCAGCAACAGTAAACCTGAAGG - Intergenic
1046745361 8:117870188-117870210 ATAAACAAAACTAAAACTGAAGG + Intronic
1046783856 8:118244901-118244923 ATGTCCAAGGATAAATCTGAAGG + Intronic
1046851216 8:118975137-118975159 AGGAGAAACAATAAAACAGAAGG + Intergenic
1047063966 8:121260027-121260049 CTGAGCAAGAAAAAAAGGGAAGG - Intergenic
1047180868 8:122586475-122586497 ATGAGAAAGAATGAATCTGAGGG - Intergenic
1047792730 8:128221045-128221067 AAGGGAAACAATAAAACTGAGGG + Intergenic
1048213106 8:132473223-132473245 ATGAGAAAGAATAAAATACATGG + Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048515296 8:135102990-135103012 AGAAGAAAGAATAAAAGTGAAGG + Intergenic
1048800863 8:138192757-138192779 TTGAGTAACAATAAAACTCAGGG + Intronic
1049068248 8:140336651-140336673 ATGAGCAAGCAACAAAATGAAGG + Intronic
1049853203 8:144845381-144845403 AGCAGCAAAAAAAAAACTGAGGG - Intronic
1049895318 9:106911-106933 ATGAGGAATAATATCACTGATGG - Intergenic
1050868308 9:10532846-10532868 ATGAGGAGCCATAAAACTGAGGG - Intronic
1051023803 9:12580614-12580636 ATCAGGAAGAATAAAGCTGAAGG - Intergenic
1051054332 9:12966026-12966048 ATTAGAATGACTAAAACTGAAGG + Intergenic
1051080550 9:13288780-13288802 AGAAGAAAGAATTAAACTGAGGG - Intergenic
1051251723 9:15166051-15166073 CTAAGCAGCAATAAAACTGAAGG + Exonic
1051780970 9:20688628-20688650 ATAAGAAAGAATAAAGCAGAAGG + Intronic
1052509132 9:29391635-29391657 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1052599721 9:30610046-30610068 AAGAGAAAGAATAAAGCAGAGGG + Intergenic
1052790408 9:32870229-32870251 ATGAGCAAGAAAAAGACATAAGG - Intergenic
1052881732 9:33604733-33604755 ATGAGCTAGAAAGAAACTGAGGG - Intergenic
1053494582 9:38541104-38541126 ATGAGCTAGAAAGAAACTGAGGG + Exonic
1053738483 9:41117011-41117033 ATGAGGAATAATATCACTGATGG - Intergenic
1053917611 9:42954939-42954961 ATGAGCTAGAAAGAAACTGAAGG - Intergenic
1054689862 9:68314303-68314325 ATGAGGAATAATATCACTGATGG + Intergenic
1055861911 9:80761773-80761795 ATGAGTAAAAATTAAACTGTTGG + Intergenic
1057240446 9:93403621-93403643 ATCAGCAAGAATCAAAATGGAGG + Intergenic
1057990177 9:99760802-99760824 ATGATCAAGAGTAAAGGTGAAGG - Intergenic
1059137770 9:111823446-111823468 AGAAGCAATAAAAAAACTGATGG + Intergenic
1059611836 9:115906360-115906382 TTGAGCAAGAACAAAGCTGGTGG - Intergenic
1060021900 9:120138927-120138949 ATGAGCAAGACCAAAACTACTGG + Intergenic
1060535586 9:124384564-124384586 TTGAAAAAGAATAAAACTGCAGG + Intronic
1061008891 9:127943775-127943797 GTGAGCAAGAAGGAAACTGAGGG - Intronic
1203432989 Un_GL000195v1:108879-108901 ATGAGCAAGAACCAAACTCTTGG - Intergenic
1186530291 X:10288360-10288382 AGGAGCAAGAAGAAAAAGGATGG - Intergenic
1186550222 X:10496799-10496821 ATGATCAGGAATAAAATTCAAGG - Intronic
1186704317 X:12125946-12125968 GTGGGCTAGAATAAAACAGAAGG - Intergenic
1186926284 X:14336334-14336356 TTTGGAAAGAATAAAACTGAAGG + Intergenic
1186995052 X:15111981-15112003 GTGAACAAGAATAAAACTATGGG - Intergenic
1187232541 X:17436272-17436294 TTGTTTAAGAATAAAACTGAAGG + Intronic
1187370128 X:18698481-18698503 ATGAGTAGGTTTAAAACTGAGGG + Intronic
1188903204 X:35760597-35760619 TTGAGAAAGAATAAAGCTGAAGG + Intergenic
1189844674 X:45123540-45123562 AAGAAAAAGAACAAAACTGAAGG - Intergenic
1190529229 X:51358297-51358319 ATGAGAAAGAAGAAAACTTAGGG + Intergenic
1191083203 X:56536170-56536192 ATCAAAGAGAATAAAACTGAAGG + Intergenic
1192693443 X:73389753-73389775 ATAATCAATAATAAAACAGATGG + Intergenic
1192991929 X:76468969-76468991 AGCAGAAAGAACAAAACTGAAGG - Intergenic
1193085381 X:77444270-77444292 ATGTGGAAAAACAAAACTGAAGG - Intergenic
1193907668 X:87262287-87262309 CTAAGCAAGAATAAAACTTTAGG + Intergenic
1194032065 X:88829573-88829595 ATGAGTATGTATTAAACTGATGG - Intergenic
1194550261 X:95289619-95289641 GTAAGCAAGGATAAACCTGAAGG - Intergenic
1194638389 X:96373505-96373527 ATGCCCAAAAATAAAACAGATGG + Intergenic
1194834562 X:98665827-98665849 AACAAAAAGAATAAAACTGAAGG - Intergenic
1195171810 X:102276112-102276134 CTAAGCAAGAACAAACCTGAAGG - Intergenic
1195187050 X:102410981-102411003 CTAAGCAAGAACAAACCTGAAGG + Intronic
1195409543 X:104555087-104555109 AGAAGCAAGAAGAAAACTCATGG - Intergenic
1195714382 X:107804362-107804384 AAGAGAAAGAAGATAACTGAAGG + Intergenic
1196509980 X:116498391-116498413 ATGAGCAGGAAGAAATCTGAAGG - Intergenic
1197180891 X:123535454-123535476 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1197557956 X:127979598-127979620 TTGAGAAAGAATAAAATTGAAGG + Intergenic
1197563836 X:128056638-128056660 ATGGGAAAGAATAACACTGAGGG - Intergenic
1198019955 X:132647626-132647648 AGGAGCAAGAATAAAGCCAATGG - Intronic
1198271814 X:135062478-135062500 ATAAGCAAGAGGAACACTGAAGG + Intergenic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1198593449 X:138210164-138210186 TTGTGAATGAATAAAACTGAAGG + Intergenic
1199099657 X:143784055-143784077 TTGTGAAAGAATAAAACTGCAGG - Intergenic
1199213773 X:145244349-145244371 ATGAGCAAACACAAAACTAAAGG - Intergenic
1199602544 X:149550730-149550752 ATGGGCAAAAATGAAACTAAAGG - Intergenic
1199647844 X:149928745-149928767 ATGGGCAAAAATGAAACTAAAGG + Intergenic
1201345403 Y:12978293-12978315 CTGAGAAAGAACAAAGCTGATGG + Intergenic
1201956043 Y:19623937-19623959 ATGAGCAAGAAACCAACAGAAGG + Intergenic