ID: 1074642374

View in Genome Browser
Species Human (GRCh38)
Location 10:115401363-115401385
Sequence CTGTGGAGAAAGAGCCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074642370_1074642374 7 Left 1074642370 10:115401333-115401355 CCAGCAGATGTCTCATATTGGCT 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074642374 Original CRISPR CTGTGGAGAAAGAGCCAGTA AGG Intronic
No off target data available for this crispr