ID: 1074642374 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:115401363-115401385 |
Sequence | CTGTGGAGAAAGAGCCAGTA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074642370_1074642374 | 7 | Left | 1074642370 | 10:115401333-115401355 | CCAGCAGATGTCTCATATTGGCT | 0: 1 1: 0 2: 0 3: 11 4: 98 |
||
Right | 1074642374 | 10:115401363-115401385 | CTGTGGAGAAAGAGCCAGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074642374 | Original CRISPR | CTGTGGAGAAAGAGCCAGTA AGG | Intronic | ||
No off target data available for this crispr |