ID: 1074643681

View in Genome Browser
Species Human (GRCh38)
Location 10:115418764-115418786
Sequence ACATTCCCTCCTGCCCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074643681_1074643682 -2 Left 1074643681 10:115418764-115418786 CCTTTCAGGGCAGGAGGGAATGT 0: 1
1: 0
2: 2
3: 33
4: 336
Right 1074643682 10:115418785-115418807 GTGACAATATATTCAGAATGTGG No data
1074643681_1074643683 2 Left 1074643681 10:115418764-115418786 CCTTTCAGGGCAGGAGGGAATGT 0: 1
1: 0
2: 2
3: 33
4: 336
Right 1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074643681 Original CRISPR ACATTCCCTCCTGCCCTGAA AGG (reversed) Intronic
900299044 1:1967602-1967624 ACCTTCTCTGGTGCCCTGAAGGG + Intronic
900878305 1:5361949-5361971 ACATCCCCTCTTGCCCTGCTGGG + Intergenic
901610429 1:10493839-10493861 GCATTCCCTCTTGGCATGAATGG - Intronic
901894006 1:12293241-12293263 ACCTTTCTCCCTGCCCTGAAAGG - Intronic
902064025 1:13669045-13669067 ACATTCCCTCCCGCTCTATATGG - Intergenic
902405678 1:16182128-16182150 GGATTCACCCCTGCCCTGAAAGG - Intergenic
902924017 1:19683687-19683709 AGATTCCTTCCTGCCCCAAAAGG - Intronic
903371807 1:22841379-22841401 AGACTCCCTCCTGCCCTACAAGG - Intronic
904271889 1:29355635-29355657 ACACTCCCTCATGCCTGGAAAGG + Intergenic
904275203 1:29378754-29378776 CCATTCCCTCCTGGCCTGTATGG + Intergenic
906117621 1:43366820-43366842 ACATTCCTTCAGGCCCTGAGGGG - Intronic
906598459 1:47102643-47102665 CCATTCTCTCCTGGCCTGAAAGG + Intronic
907023973 1:51096672-51096694 GCATTCTCTCTTGCCCTGTAAGG - Intergenic
907238634 1:53068395-53068417 ACATTCACTCCTGAGCTGAGTGG - Intronic
907491346 1:54810797-54810819 ACCTTTCCTCCTGCCCCGCAAGG + Intronic
908173568 1:61531470-61531492 ACAATTCCTCCTGACATGAAAGG + Intergenic
908389507 1:63671941-63671963 TCATTCTCTCCTGCACTGACAGG - Intergenic
909870513 1:80732780-80732802 CCATTCTCTCCTGACCTGCAAGG - Intergenic
910975278 1:92899948-92899970 CCATTCTCTCCTGGCCTGTAAGG + Intronic
912639432 1:111331025-111331047 CCATTCTCTCCTGCCCTATAAGG + Intergenic
912870549 1:113300796-113300818 ACCTTCCATTCAGCCCTGAAAGG + Intergenic
912899059 1:113628736-113628758 CCACTCTCTCCTGCCCTGTAAGG + Intronic
915902841 1:159858605-159858627 CCATTGCCTCATTCCCTGAAAGG + Intronic
919066728 1:192700933-192700955 ACATTCCCTCCTCAGCTGTAAGG - Intergenic
919095874 1:193035410-193035432 CCACTCCCTCCTGGCCTGTATGG - Intronic
919283896 1:195527882-195527904 ACATTCCCTCCTACACTATAGGG - Intergenic
919728909 1:200900643-200900665 ACTTTCCCTCCTGACCCCAAAGG - Intronic
920426256 1:205878487-205878509 CCATTCTCTCCTGGCCTGCAAGG + Intergenic
921462024 1:215439814-215439836 TCATTCTCTCCTGACCTGTAAGG + Intergenic
923213088 1:231823809-231823831 ACAGTCCCTCCTGCTTTGAAGGG - Intronic
1062896730 10:1108991-1109013 CCTTTCCATCCTGCCCTCAAAGG - Intronic
1065521241 10:26575443-26575465 ACTTTGCCTTCTGCCATGAATGG - Intergenic
1065526660 10:26629101-26629123 ACTTTGCCTTCTGCCATGAATGG - Intergenic
1065886036 10:30078017-30078039 ACATTCCCACCAGCAATGAAGGG + Intronic
1065922034 10:30401473-30401495 ACACTCCCTTCTGGCCTGTAAGG - Intergenic
1066295688 10:34052382-34052404 AAATACCCTCCTCCACTGAAAGG + Intergenic
1067539408 10:47140859-47140881 TCATGGCATCCTGCCCTGAAAGG - Intergenic
1068663151 10:59645082-59645104 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1069573318 10:69507366-69507388 CCCTTCCCTCCTGCCCCGAGGGG - Exonic
1070285358 10:75079522-75079544 ACCTTCCCTCCTGCCCTGCCTGG + Intergenic
1070696061 10:78564053-78564075 ACATTACCTCCTGCCATGTCTGG - Intergenic
1071249300 10:83800752-83800774 CCACTCCCTCCTGGCCTGTATGG + Intergenic
1071935334 10:90524520-90524542 CCATTCTCTCTTGCCCTGTAAGG + Intergenic
1072114149 10:92353112-92353134 ACCCTCCCTCCTGCCCCAAAAGG - Exonic
1074643681 10:115418764-115418786 ACATTCCCTCCTGCCCTGAAAGG - Intronic
1075649661 10:124119299-124119321 ACCTTCCTTCCTGGCCTAAAGGG - Intergenic
1076867865 10:133177001-133177023 GCGTTCCCTGCTGCCCTGCATGG + Intronic
1076990517 11:271109-271131 AAAATCCCTCTTGCCCTGCAGGG - Intergenic
1077341969 11:2030257-2030279 AAACTCCATGCTGCCCTGAAGGG - Intergenic
1077930427 11:6725631-6725653 CCATTCCCTCCTGACCTATATGG - Intergenic
1078030892 11:7749963-7749985 TCACTCCCTCCTCCCCTGGAAGG - Intergenic
1078332733 11:10439239-10439261 ACAGGCCCTCCTGAGCTGAAAGG + Intronic
1078334915 11:10455730-10455752 CCATCCCCTCCTCCTCTGAAAGG - Intronic
1079656677 11:22994090-22994112 ACTTTTCCCCCTGCCATGAAAGG + Intergenic
1079781932 11:24618130-24618152 ACATTCCCCCATCCCCTGAGTGG - Intronic
1080935294 11:36856991-36857013 ACTTTCCCTACTGCCAGGAAAGG - Intergenic
1081146365 11:39565651-39565673 ATCGTCCATCCTGCCCTGAAGGG - Intergenic
1081979690 11:47258485-47258507 ACATTCCCTGCTGGCCTGGAGGG + Exonic
1082210925 11:49499937-49499959 CCACTCCCTCCTGGCCTGCAAGG - Intergenic
1084601870 11:70150407-70150429 TCATTCCCACCTACCCTGAAGGG - Intronic
1085023920 11:73225588-73225610 CCACTACCTCCTGCCCTGCAAGG - Intronic
1085178659 11:74512943-74512965 CCATTCTCTCCTGGCCTGTAAGG - Intronic
1085859635 11:80216636-80216658 CCATTCTCTCCTGGCCTGGAAGG - Intergenic
1086184838 11:84000677-84000699 GCATTTCCTCCTGCCCGGTATGG - Intronic
1086500837 11:87451663-87451685 CCAAACCCTCCTGCCCTGAGCGG - Intergenic
1086638719 11:89125058-89125080 CCACTCCCTCCTGGCCTGCAAGG + Intergenic
1086987662 11:93267648-93267670 ACATTTCCCCCTGCCATGAAAGG - Intergenic
1087304763 11:96475087-96475109 CCATTCTCTCCTGTCCTGCAAGG - Intronic
1087834921 11:102863740-102863762 ATAGTCCCTTCTGCCCTGATAGG - Intronic
1090930866 11:131297080-131297102 ATCTTCCCTACAGCCCTGAAAGG - Intergenic
1091131219 11:133148680-133148702 ACTTCCCCTCCTCCCCTGGAGGG - Intronic
1091247425 11:134110201-134110223 ACATTCCCACCTGCAATGGATGG - Intronic
1202824955 11_KI270721v1_random:85446-85468 AAACTCCATGCTGCCCTGAAGGG - Intergenic
1091520227 12:1232106-1232128 TCATTCCCTCCTGATCTGCAAGG + Intronic
1091598000 12:1892226-1892248 TCATTCTCTCCTGATCTGAAAGG - Intronic
1091900537 12:4140826-4140848 ACCGTCTCTGCTGCCCTGAAGGG + Intergenic
1092438261 12:8471849-8471871 ACAGTCCCTTCTGTCCTGCAAGG + Intronic
1092671189 12:10862568-10862590 TCATTCTCTCCTGGCCTGTAAGG - Intronic
1095860435 12:46910229-46910251 CCACTCTCTCCTGACCTGAAAGG - Intergenic
1095911015 12:47426404-47426426 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
1096961210 12:55579714-55579736 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1098395500 12:70012668-70012690 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
1098891519 12:76014177-76014199 AGTTAGCCTCCTGCCCTGAAAGG + Intergenic
1100461320 12:94802273-94802295 ACATTACCTTCTGCACTAAAGGG - Intergenic
1100991839 12:100259782-100259804 TCATTCCCTCCTCCCCAGACAGG - Intronic
1104051021 12:125193960-125193982 AGAGTCCATTCTGCCCTGAATGG - Intronic
1104642296 12:130475256-130475278 ACCTGTCCTCCTGCCCTGCATGG - Intronic
1105591435 13:21796235-21796257 TCATTCCCTCCTGCCCGGGTCGG + Intergenic
1107592703 13:41925077-41925099 CCATTCTCTCCTGGCCTGCATGG - Intronic
1108090953 13:46849355-46849377 ACCTTCCCCACTGCCCTCAAGGG + Intronic
1108138188 13:47387817-47387839 CCACTCTCTCCTGGCCTGAAAGG - Intergenic
1108196450 13:48000798-48000820 GCATTCCCCCCTGCCCAAAAAGG + Intronic
1108508536 13:51134884-51134906 GCCTTCCCTCCTGACCTGGATGG + Intergenic
1108769271 13:53678934-53678956 TCATTCCCTCCTGGACTGTATGG + Intergenic
1111041890 13:82758828-82758850 TCATTCTTTCCTGTCCTGAATGG - Intergenic
1111722030 13:91957616-91957638 CCATTCTCTCCTGACCTGTAAGG - Intronic
1112506431 13:99979109-99979131 AGATTCTCACCTTCCCTGAAAGG - Intergenic
1112972260 13:105274319-105274341 ACATTAGCTCCTGACCTGGATGG - Intergenic
1113335337 13:109371276-109371298 CCATTTCCTCCTGCCCAGAGGGG - Intergenic
1114143332 14:19942385-19942407 CCATTCTCTCCTGGCCTGCAAGG - Intergenic
1114773056 14:25450889-25450911 AGATTTCCTTCTTCCCTGAAGGG + Intergenic
1115766757 14:36631011-36631033 ACAGTCACTCCTACCTTGAATGG + Intergenic
1116031252 14:39575516-39575538 CCACTCCCTCCTGGCCTGTATGG + Intergenic
1116513926 14:45783388-45783410 TCACTCTCTCCTGGCCTGAAGGG + Intergenic
1116750778 14:48880934-48880956 CCACTCCCTCCTGGCCTGTATGG - Intergenic
1116889322 14:50251691-50251713 CCACTCCCTCCTGGCCTGTAAGG - Intronic
1117871024 14:60200266-60200288 CCATTCTCTCCTGGCCTGTAGGG - Intergenic
1118034026 14:61847372-61847394 CCATTCTCTCCTGACCTGTATGG + Intergenic
1119385714 14:74257231-74257253 ACTGTCCTCCCTGCCCTGAAGGG - Intronic
1121509293 14:94500502-94500524 AAATTCCCGCCTGCACTGATTGG - Intronic
1122426734 14:101613558-101613580 ACATTCCCTCGAGCAATGAATGG - Intergenic
1124633898 15:31353040-31353062 GCAGTCCCTCCTCCCCTGGAAGG - Intronic
1128005918 15:64240597-64240619 TCATTCTCTCCTGGCCTGTAAGG - Intronic
1128160127 15:65418133-65418155 ACATCCTTTCTTGCCCTGAAGGG - Intronic
1128868920 15:71137346-71137368 ACATTATCTCAGGCCCTGAAAGG - Intronic
1128871658 15:71162454-71162476 TCATTCTCTCCTGGCCTGAAAGG + Intronic
1129868812 15:78928167-78928189 GCCTTCTCTCCTGCCTTGAAAGG - Intronic
1132117609 15:99148967-99148989 ATGTACCCTCCTGCACTGAATGG - Intronic
1132199590 15:99941811-99941833 CCATTCTCTCCTGCCCTACAAGG + Intergenic
1132199633 15:99942470-99942492 ACCTTCCCCCCTCCCCAGAAAGG - Intergenic
1134406826 16:13968112-13968134 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1136402167 16:30024911-30024933 ACAAGCCCTCCTGCCCTCAGTGG + Exonic
1136580271 16:31147387-31147409 TCATCACCTCCTGCCCTGATGGG + Intronic
1136636555 16:31528033-31528055 AAAATCCCTCCTGCCCTGCAGGG - Intronic
1137070316 16:35899186-35899208 ACATTCCCTGCTCCCATGACAGG + Intergenic
1140301051 16:73757500-73757522 ACATTCCCTACTGTCCTCATGGG - Intergenic
1141037517 16:80641278-80641300 CCATTCTCTCCTGGCCTGTAAGG - Intronic
1141201537 16:81902194-81902216 ACACTCGCTCCTTCCATGAAAGG - Intronic
1141573298 16:84947820-84947842 ACATTCCCTTCTGACCTGGGTGG - Intergenic
1142833407 17:2566175-2566197 AAAATCCTTCCTGCCATGAAAGG - Intergenic
1144313496 17:14036632-14036654 ACTTTCCCTTCTGCCATGATTGG - Intergenic
1144506394 17:15834819-15834841 ACATTCCCCTCTGCTCTGGATGG + Intergenic
1145118398 17:20232953-20232975 ACATTCCCTTCTGCTCTTGATGG + Intronic
1145170570 17:20652752-20652774 ACATTCCCCTCTGCTCTGGACGG + Intergenic
1148747387 17:49926299-49926321 ACAGTCCCCTCTGCTCTGAAGGG + Intergenic
1148781998 17:50127759-50127781 ACATTTCTTCCTGTCCTGACAGG + Intronic
1150448442 17:65245659-65245681 ACTTTGCCTTCTGCCCTGATTGG - Intergenic
1151885876 17:76923193-76923215 ACTTTTCCACCTGGCCTGAATGG + Intronic
1151892789 17:76960663-76960685 AGATTTCCTCCTTCTCTGAAAGG - Intergenic
1153491098 18:5648617-5648639 ACATTCCCTCCTCCCTAGACTGG - Intergenic
1154184056 18:12165951-12165973 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1155179696 18:23333698-23333720 GCCTTGCCTTCTGCCCTGAAAGG - Intronic
1155414192 18:25579862-25579884 CCATTCTCTCCTGGCCTGCAAGG + Intergenic
1157217143 18:45793718-45793740 ACATTCCCACCAGCCCTGGGTGG - Intergenic
1157751894 18:50186583-50186605 CCCTTCCCTGCTGTCCTGAAGGG - Intronic
1159775169 18:72596739-72596761 ACACTCTCTCCTGGCCTGTATGG + Intronic
1159907107 18:74103688-74103710 TCATTCCCTCCTGGCCTGTATGG - Intronic
1161125776 19:2556408-2556430 TGTTTCCCTCCTGCCCTGAAGGG + Intronic
1161295707 19:3519231-3519253 AGAGTCCCTGCTGCCCTGCAAGG + Intronic
1162254530 19:9478210-9478232 CCATTCTCTCCTGGCCTGTAAGG - Intronic
1162537727 19:11273530-11273552 TCATTGCCACCTGCTCTGAAAGG - Intergenic
1163300251 19:16441000-16441022 ACAGTCACTCCTGCCCCGCAAGG - Intronic
1164761295 19:30730280-30730302 ACCTGGCCTCCTGCACTGAAAGG + Intergenic
1165017577 19:32892629-32892651 TCATTCTCTCCTGGCCTGTAAGG - Intronic
1165100166 19:33434540-33434562 CCATTCCCGCCTGCCCTGCCAGG - Intronic
1165956248 19:39503688-39503710 ACACTCCCATCTTCCCTGAAAGG + Intronic
1166408064 19:42537523-42537545 ACACTCTCTCCTGGCCTGTAAGG + Intronic
1167641428 19:50684557-50684579 ACAATCCCTCATGCTCTGGAGGG - Intronic
926260741 2:11258403-11258425 ACAAAGCCTCCTGCCTTGAAAGG - Intronic
927151741 2:20200178-20200200 ACGGTCCCTCCTGCTCTGCAGGG + Intergenic
927514708 2:23665407-23665429 AAATTCCATCATGGCCTGAAGGG + Intronic
927652925 2:24923086-24923108 TCCTTCCCTCTTGCCCTGAAAGG - Intergenic
928485894 2:31730699-31730721 CCATTCCCTTCTGGCCTGTAAGG - Intergenic
928495478 2:31827519-31827541 CCATTCTCTCCTGACCTGTAAGG + Intergenic
928609718 2:32980899-32980921 ACACTCTCTCCTGGCCTGTAAGG + Intronic
929925266 2:46202271-46202293 ACATTCTCCCCTGCCTTGCAGGG + Intergenic
931261958 2:60628031-60628053 ACCTTCCCTCCAGCCTTGAAGGG - Intergenic
932946458 2:76238114-76238136 GCATTCCCTCCTGTCCTGTAAGG + Intergenic
933098066 2:78212589-78212611 ACATTCTGTCCTGGCCTGTAAGG - Intergenic
933173280 2:79148844-79148866 CCACTCTCTCCTGCCCTGAAAGG + Intergenic
933975589 2:87506858-87506880 ACCTTCGCCCCTGCCCAGAATGG - Intergenic
934973998 2:98787559-98787581 ACATCCTGTCCTGCACTGAACGG + Intergenic
936318236 2:111443955-111443977 ACCTTCGCCCCTGCCCAGAATGG + Intergenic
937173770 2:119904710-119904732 ATATTCGCTCCTGGCCTGTAAGG - Intronic
937523034 2:122734806-122734828 ACTTTACCTGGTGCCCTGAAAGG + Intergenic
937987741 2:127646083-127646105 ACAGCCCCTCTGGCCCTGAAAGG - Exonic
938036867 2:128041877-128041899 ACATTTCCCCCTGCCATGAAAGG - Intergenic
938332395 2:130456939-130456961 ACATTCCCTACTTCCTTGAGTGG - Intergenic
938357412 2:130663729-130663751 ACATTCCCTACTTCCTTGAGTGG + Intergenic
938477884 2:131633162-131633184 ACATTCCCTACTTCCTTGAGTGG + Intergenic
938624158 2:133090533-133090555 ACATTCCCTTGGGCTCTGAAGGG - Intronic
938800005 2:134753231-134753253 CCACTCCCTCCTGGCCTGTATGG - Intergenic
939244621 2:139608180-139608202 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
940249968 2:151664391-151664413 GCATTCCCACCAACCCTGAATGG + Intronic
940429584 2:153574171-153574193 TCATTCTCTCCTGGCCTGTAAGG + Intergenic
940468847 2:154066548-154066570 TCATTCTCTCCTGGCCTGTAGGG - Intronic
942975526 2:182013354-182013376 ACACTCTCTCCTGGCCTGTAAGG + Intronic
943485280 2:188472090-188472112 ACATTCTCTCTTGGCCTGTAAGG + Intronic
943659374 2:190541910-190541932 CCATTTCCTCCTGGCCTGTATGG + Intergenic
945483306 2:210366875-210366897 ACTTTTCCCCCTGCCATGAAAGG + Intergenic
945575855 2:211527263-211527285 CCACTCCCTCCTGGCCTGTAAGG - Intronic
948712079 2:239831489-239831511 ACATTCCTCCCAGCCCGGAAGGG - Intergenic
948714357 2:239850615-239850637 TCATTCTCTCCTGCCCTGAAAGG + Intergenic
949026832 2:241770315-241770337 ACCTGCCCTCCTGCCCTGGGTGG + Intergenic
1168780801 20:488121-488143 GCATTCCCTCCTGGGCTCAAGGG + Intronic
1168822610 20:785800-785822 ACTTTTCCCCCTGCCGTGAAAGG + Intergenic
1170863349 20:20129391-20129413 TCACTCCCACCTGCCCTGTATGG + Intronic
1172177404 20:32980651-32980673 ACACTCCCTCCTGTCCTCCAAGG - Intergenic
1172220428 20:33270700-33270722 CCCTTGCCCCCTGCCCTGAATGG - Intergenic
1173070651 20:39761536-39761558 CCATTCCCTTCTGCCATGATTGG - Intergenic
1176359251 21:5981025-5981047 ACATTCTCTCCTGGCTTGTAAGG + Intergenic
1178243314 21:30927259-30927281 CCATTCTCTCCTGGCCTGCAAGG - Intergenic
1178539234 21:33435349-33435371 CCAGTCCCTCCTTCACTGAAAGG + Intronic
1179187772 21:39097790-39097812 ACATAGCTTCCTGCCCTCAAAGG - Intergenic
1179764267 21:43557525-43557547 ACATTCTCTCCTGGCTTGTAAGG - Intronic
1179819606 21:43929186-43929208 ACATGCCCTGCTTCCATGAAAGG - Intronic
1183349257 22:37325446-37325468 ACACTGCCTCCTGCCCAAAATGG + Intergenic
1183648595 22:39140919-39140941 ACACTCCTTCCTGCCCTAAGAGG + Intronic
949609785 3:5692529-5692551 ACTTTTCCCCCTGCCGTGAAAGG + Intergenic
950387391 3:12670947-12670969 CCATGCCATCCTGCCCTGCAGGG + Intergenic
950521695 3:13501431-13501453 TCATTCCCTCCTCCCCAGGAAGG - Intronic
951102504 3:18705106-18705128 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
951382485 3:22000714-22000736 CCATTCTCTCCTGGCCTGTAAGG - Intronic
951625742 3:24661470-24661492 TCATTCTCTCCTGGCCTGAAAGG + Intergenic
952560986 3:34593181-34593203 ACATTTCCACCTGGCCAGAAGGG - Intergenic
952919274 3:38274173-38274195 CCATGAGCTCCTGCCCTGAAGGG + Intronic
954975715 3:54692353-54692375 AAATGCTCTCCTGACCTGAAGGG - Intronic
957447758 3:80337254-80337276 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
957755439 3:84478879-84478901 TCATTCTCTCCTGGCCTGCAGGG - Intergenic
958032326 3:88126966-88126988 ACAAAGCCTCCTGCCTTGAAAGG - Intronic
958639945 3:96793268-96793290 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
959766383 3:110035155-110035177 CCACTCCCTCCTGGCCTGTATGG + Intergenic
959804035 3:110529601-110529623 TCTTTCTCTCCTGTCCTGAAAGG - Intergenic
959929772 3:111967175-111967197 CCTTTGCATCCTGCCCTGAAGGG + Intronic
960130335 3:114048966-114048988 ACTTTTCCTCCTGCCCTTTATGG + Intronic
960866679 3:122208761-122208783 TCTTTCCCTCCAGCACTGAATGG + Intronic
962605108 3:137026339-137026361 ACTCTCCCTTCTGCCCTAAAGGG - Intergenic
962824428 3:139087647-139087669 ACATTCCCTCCTTCTTTTAATGG - Intronic
963812956 3:149797550-149797572 ACACTTCCTCCTCCCCTGAAGGG - Intronic
964473371 3:157077200-157077222 ACACTCACTTCTGCCCTGAGGGG - Intergenic
965701927 3:171466961-171466983 ACAGTCCCTCTTGCCTTGTAAGG - Intergenic
966489985 3:180516898-180516920 AGACTCTCCCCTGCCCTGAATGG + Intergenic
967508760 3:190285766-190285788 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
967551293 3:190798526-190798548 CCATTCTCTCCTGCCCTGTAAGG - Intergenic
968429171 4:545123-545145 ACATTCCCACCTGTGCTGCAGGG - Intergenic
973287713 4:48438546-48438568 CCACTCTCTCCTGCCCTGTAAGG + Intergenic
973605184 4:52579953-52579975 TAAGTCCCTCCTGCCCTGTAGGG + Intergenic
974155840 4:58070983-58071005 CCATTCCCTCAAGCCCTTAAGGG - Intergenic
974593084 4:63981666-63981688 CCATTCCCTCCTGGCCTGTAAGG + Intergenic
974784382 4:66598707-66598729 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
975665967 4:76735392-76735414 ATTTTCCCTCCTGCCCGGAGAGG - Intronic
977179798 4:93859070-93859092 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
977396843 4:96481901-96481923 CCACTCTCTCCTGACCTGAAAGG - Intergenic
977873444 4:102121843-102121865 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
978138089 4:105287782-105287804 CCATTCTCTTCTGGCCTGAAAGG + Intergenic
978513744 4:109549468-109549490 ACATTCCGTACTGTGCTGAAGGG + Intergenic
978613827 4:110573248-110573270 TCATTCTCTCCTGGCCTGTAAGG - Intergenic
978643870 4:110905916-110905938 ACTTTTCCTACTGCCCTGCATGG + Intergenic
979380872 4:120005247-120005269 TCACTCCCTCCTGGCCTGTATGG - Intergenic
979500863 4:121438383-121438405 ACATTCTCTTCTGTTCTGAAGGG + Intergenic
981159482 4:141480696-141480718 CCATTCCCTCCTGCCCTGTATGG + Intergenic
981250984 4:142600290-142600312 CCATTCTCTCCTGTCCTGTAAGG - Intronic
981625511 4:146749857-146749879 CCATTCTCTCCTGGCCTGCAAGG - Intronic
981670468 4:147280240-147280262 CCATTGCATCCTGCCCTGCAGGG + Intergenic
982869415 4:160558334-160558356 ACATTTATTCCTGCCCAGAATGG + Intergenic
983455634 4:167959801-167959823 TCACTCCCTCCTGGCCTGTATGG - Intergenic
983949751 4:173626033-173626055 GCATTCTCTCCTGACCTGTAAGG + Intergenic
986049465 5:4075271-4075293 CCTCTCCCTCCTGGCCTGAAGGG + Intergenic
988299788 5:29407062-29407084 ACATTCTCTCTTGTCCTGCAAGG - Intergenic
988826808 5:34944551-34944573 ACATTCCCCCATCCCCAGAAAGG + Intronic
989420988 5:41239929-41239951 CCATTCTCTCCTGGCCTGTAGGG + Intronic
990733983 5:58839948-58839970 CCATTCCCTCCTGTCCTATAGGG + Intronic
993437651 5:87917379-87917401 ACATTCTCTCTTGGCCTGCAAGG - Intergenic
993899362 5:93573817-93573839 ACATTCTCTCCTGCCCAGGTTGG - Intergenic
994726231 5:103439375-103439397 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
995278381 5:110305529-110305551 ACACTCTCTCCTGTCCTGTAAGG + Intronic
996424623 5:123300622-123300644 CCACTCTCTCCTGCCCTGCAAGG - Intergenic
996974636 5:129415812-129415834 GCATTCCCTTCTGGCCTGTAAGG - Intergenic
997229447 5:132232007-132232029 ACATTCCTCCATGCCCTCAAAGG + Intronic
997664491 5:135618818-135618840 TCATTCTCTCCTGGCCTGTAAGG + Intergenic
998411374 5:141914178-141914200 ACGTTCCCTCCAGCCTTGAGGGG - Intergenic
999067680 5:148708438-148708460 CTATTCCTTCCTGCACTGAATGG - Intergenic
999079896 5:148833233-148833255 CTATTCCTTCCTGCCCTGTAGGG - Intergenic
999292370 5:150434653-150434675 GCCTCCCCTCCTGCCCTGACAGG + Intergenic
999800486 5:155029068-155029090 CCATTCCCTCCTGGCCTGTATGG - Intergenic
1000539597 5:162523763-162523785 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1002318620 5:178361881-178361903 ACATTCCCGCCTCCCCTCCAGGG + Intronic
1003415654 6:5905661-5905683 ACATTCCCTGCTGCCAGGATTGG + Intergenic
1003453260 6:6257032-6257054 AAATTCCTTCCTTCCCTAAATGG - Intronic
1003681730 6:8263889-8263911 AGATGCTCTCCTGCCCTGCAGGG - Intergenic
1004795131 6:19073816-19073838 CCATTCCCTCCAGGCCTGTAAGG - Intergenic
1005883758 6:30079246-30079268 ACATTCCCTAGTGCCATGCATGG - Intergenic
1006011352 6:31045341-31045363 ACCTTCCCTCATTCCCTGGAGGG - Intergenic
1007284939 6:40740955-40740977 TCTTTCCCTCCTGCCCTCCAGGG + Intergenic
1007404684 6:41627766-41627788 AAAGTCCCTCTTGCCCTGTATGG + Intergenic
1007805618 6:44443181-44443203 CCACTCCCTTCTGGCCTGAAAGG + Intronic
1008882034 6:56389751-56389773 CCATTCTCTCTTGCCCTGTAAGG - Intronic
1009994837 6:70886568-70886590 ACTTCCCCTTCAGCCCTGAAAGG + Intronic
1010987194 6:82438447-82438469 TCATTCCCTCCTGACCTATAAGG - Intergenic
1012325720 6:97914247-97914269 ACATTGCCCCCTCCCCTGAATGG - Intergenic
1013184097 6:107742613-107742635 CCATTCCCTCCTGGCCTATATGG - Intronic
1014736771 6:125103106-125103128 ACATTCCCTTCTTCCCTATATGG + Intergenic
1014928586 6:127305243-127305265 CCATTCTCTCCTGGCCTGTAAGG - Intronic
1016054377 6:139564221-139564243 ACACTCCCTCCTGGCCTGTAAGG + Intergenic
1016651031 6:146461180-146461202 CCATTCCCTCCTGGCCTGTATGG + Intergenic
1017956658 6:159183861-159183883 ACATGAGCTCGTGCCCTGAATGG - Intronic
1018596883 6:165490257-165490279 ACAATCCCTTCTGACCTGTAGGG - Intronic
1019134302 6:169898716-169898738 ACATACTCTCCTTCCCTGAGAGG + Intergenic
1022549491 7:31225319-31225341 TCATTCTCTCCTGACCTGTAAGG + Intergenic
1023397004 7:39760532-39760554 ACTTTTCCCCCTGCCATGAAAGG - Intergenic
1023918683 7:44609797-44609819 ACATTCCCACCGGCACTGTATGG + Intronic
1024134837 7:46396041-46396063 GCTGTCCCTCCTGCCTTGAAAGG - Intergenic
1025018476 7:55462163-55462185 ACATTCTCTCCTGGCCTGTAAGG + Intronic
1028626434 7:92882349-92882371 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
1030370284 7:108692469-108692491 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1030723708 7:112899742-112899764 TCATTCCCTCTTGGCCTGTAAGG - Intronic
1031078710 7:117238427-117238449 ACATTCCCTGCTGGCTTGAGGGG - Intergenic
1031658024 7:124381949-124381971 CCATTCTCTCCTGACCTGTAAGG - Intergenic
1033602180 7:142896405-142896427 CTCTTCCCTCCTGCCCTGCATGG + Intergenic
1033682754 7:143611824-143611846 CCATTCTCTCCTGGCCTGCAAGG + Intergenic
1033701861 7:143845819-143845841 CCATTCTCTCCTGGCCTGCAAGG - Intergenic
1034357413 7:150462662-150462684 CCATTCTCTCCTGACCTGCAAGG + Intronic
1034906327 7:154950515-154950537 GCATTCCCACCTGCAGTGAATGG - Intronic
1036086987 8:5623277-5623299 AAATTCCCTTCTGCCATGTAAGG - Intergenic
1036409959 8:8490533-8490555 ATATTCCCTCCTGCACAGAAAGG + Intergenic
1037353889 8:17997211-17997233 ACACTCTCTCCTGACCTGTAAGG + Intronic
1037963557 8:23117050-23117072 AAATTCCTTCCTTACCTGAAAGG + Exonic
1039021552 8:33212385-33212407 ACATTCCCTTCTGACCATAAGGG + Intergenic
1039341465 8:36654837-36654859 TGATTCACTCCTTCCCTGAAAGG - Intergenic
1040913488 8:52544589-52544611 CCATTCCCTCCCTCCCTCAACGG - Intronic
1041224131 8:55681928-55681950 ACACACCCTCCTACCCAGAATGG + Intergenic
1041606734 8:59790782-59790804 TCACTCCCTCCTGGCCTGTAAGG - Intergenic
1041823477 8:62065202-62065224 CCACTCCCTCCTGGCCTGTAAGG - Intergenic
1043340087 8:79227925-79227947 ACACTCTCTCCTGGCCTGTAAGG + Intergenic
1044192840 8:89340553-89340575 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1045187940 8:99857427-99857449 AGATTCCCTTTAGCCCTGAATGG - Intronic
1045800873 8:106098876-106098898 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
1045853636 8:106735247-106735269 ACATTTACTCATGCCCTGATGGG - Intronic
1047933823 8:129755285-129755307 CCATTCTCTCCTGGCCTGTAAGG - Intronic
1047991125 8:130287906-130287928 ACATACCCTCTTGCCCTGTTAGG + Intronic
1048778523 8:137975253-137975275 ACCTTCCCTTCAGCCCTGTAAGG + Intergenic
1049494939 8:142925503-142925525 ACATTCCCTCTTTCCCTTCAAGG - Intergenic
1050644057 9:7700555-7700577 CCACTCTCTCCTGCCCTGTAAGG + Intergenic
1052608851 9:30742802-30742824 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1053028264 9:34749902-34749924 TTATTCTCTCCTGCCCTGTAAGG - Intergenic
1053140245 9:35677947-35677969 TCAATCCCTCCTGCACTGGAGGG - Intronic
1055550899 9:77431480-77431502 ACATTTCCCCCTGCTCTAAAAGG - Intronic
1056186208 9:84137472-84137494 ACAGTCCCTCCTGCACTGCCTGG - Intergenic
1057055108 9:91954453-91954475 ACGTTCCCTCCTGCACTTGATGG + Intergenic
1058852230 9:109023929-109023951 ACAATCCCTGTTGCTCTGAAAGG - Intronic
1059094808 9:111401071-111401093 TCACTCCCTCCTGGCCTGTAAGG - Intronic
1059556474 9:115285546-115285568 GCATTGCCTGCTGCCCTTAAAGG + Intronic
1060040646 9:120297408-120297430 ACATTCCTTCCTGCAGGGAAGGG - Intergenic
1061348594 9:130045853-130045875 TCACTTCCTCCTGCTCTGAAGGG - Intergenic
1062228159 9:135465558-135465580 TCATTCCCTCCTGCCCTGCGTGG - Intergenic
1185880852 X:3739579-3739601 GCATTCCCACCAGCCATGAATGG - Intergenic
1188064939 X:25647406-25647428 CCATTCCCTCCTGGCCTGTACGG + Intergenic
1188757774 X:33985818-33985840 TCACTCCCTCCTGGCCTGTAAGG + Intergenic
1189127202 X:38461255-38461277 TCTTTCCCTTCTGCCATGAATGG - Intronic
1190374131 X:49772985-49773007 CCATTCTCTCCTGGCCTGTAAGG + Intergenic
1191198782 X:57754136-57754158 TCATTCTCTCCTGACCTGTAAGG - Intergenic
1191634027 X:63356456-63356478 CCACTCCCTCCTGGCCTGAAAGG - Intergenic
1191929551 X:66355096-66355118 CCACTCCCTCCTGGCCTGCAAGG - Intergenic
1191995163 X:67087578-67087600 CCATTCTCTCCTGTCCTGTAAGG + Intergenic
1192788500 X:74356587-74356609 TCATTCTCTCCTGGCCTGCAAGG - Intergenic
1193245988 X:79230734-79230756 ACACTCCCTCCTGGCCTATAAGG + Intergenic
1193629180 X:83860473-83860495 ACATTCCTACCTGCCCAGAAAGG + Intergenic
1193665605 X:84311795-84311817 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
1193673738 X:84420811-84420833 CCATTCTCTCCTGGCCTGTAAGG - Intronic
1193776105 X:85643673-85643695 ACAATCACTCCTGGCTTGAAAGG - Intergenic
1194921795 X:99776621-99776643 CCACTCTCTCCTGGCCTGAAAGG + Intergenic
1195201161 X:102551393-102551415 TCAGTCCCTCCTGCCCTGTAGGG - Intergenic
1195820291 X:108937970-108937992 TCATTCTCTCCTGGCCTGTAAGG + Intergenic
1195858551 X:109356723-109356745 ACTTTGCTTCCTGTCCTGAAAGG + Intergenic
1197602421 X:128546392-128546414 CCATTCCCTCCTGGCCTGTAAGG + Intergenic
1198612169 X:138413396-138413418 CCATTCTCTCCTGGCCTGTAAGG - Intergenic
1199144068 X:144345259-144345281 CCACTCTCTCCTGGCCTGAAAGG + Intergenic
1199442859 X:147888389-147888411 ACACTCTCTCCTGGCCTGTAGGG + Intergenic
1199455762 X:148026530-148026552 ACAGTCCCCTCTGCTCTGAATGG - Exonic
1199459346 X:148067549-148067571 TCATTCCCACCTGGCCTGTATGG + Intergenic
1199908955 X:152263898-152263920 CCATTCTCTCCTGTCCTGTAAGG - Intronic
1200784098 Y:7243949-7243971 ACATTCCCACCAGCCATGAATGG + Intergenic