ID: 1074643683

View in Genome Browser
Species Human (GRCh38)
Location 10:115418789-115418811
Sequence CAATATATTCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074643681_1074643683 2 Left 1074643681 10:115418764-115418786 CCTTTCAGGGCAGGAGGGAATGT 0: 1
1: 0
2: 2
3: 33
4: 336
Right 1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074643683 Original CRISPR CAATATATTCAGAATGTGGA AGG Intronic
No off target data available for this crispr