ID: 1074647379

View in Genome Browser
Species Human (GRCh38)
Location 10:115474197-115474219
Sequence ATGTTGCCCTTCAGAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 6, 3: 113, 4: 448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074647379_1074647384 2 Left 1074647379 10:115474197-115474219 CCTTCATTTCTGAAGGGCAACAT 0: 1
1: 0
2: 6
3: 113
4: 448
Right 1074647384 10:115474222-115474244 CCAGGTAAGGTATTCTTGGTTGG No data
1074647379_1074647382 -2 Left 1074647379 10:115474197-115474219 CCTTCATTTCTGAAGGGCAACAT 0: 1
1: 0
2: 6
3: 113
4: 448
Right 1074647382 10:115474218-115474240 ATTGCCAGGTAAGGTATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074647379 Original CRISPR ATGTTGCCCTTCAGAAATGA AGG (reversed) Intronic
900736447 1:4302340-4302362 ATGGGGCCCTGCAGAAATGAGGG - Intergenic
903176543 1:21584931-21584953 CCGTTGCCCTGCAGAAATGTGGG - Intergenic
903824355 1:26132381-26132403 AAGTTGTCCTTCAAAAGTGATGG + Intergenic
904373009 1:30062551-30062573 ACTTAGCCCTTCAGAAATGCAGG + Intergenic
904895213 1:33812201-33812223 CTGTGGCCCTTCAGAGAGGAGGG - Intronic
905496864 1:38396840-38396862 AATCTGTCCTTCAGAAATGAAGG + Intergenic
906050252 1:42865116-42865138 AAGGTATCCTTCAGAAATGAAGG + Intergenic
906573422 1:46864489-46864511 AAGTTATCCTTCATAAATGAAGG + Intergenic
906837369 1:49098496-49098518 CTTTTGCCCTTTAGAGATGATGG - Intronic
907327320 1:53647420-53647442 AGGTGGCCCTTCAGAAAAGTGGG + Intronic
908341161 1:63180812-63180834 CTGTTGCCATTCAGAAATGCAGG - Intergenic
908885978 1:68788497-68788519 ACACTGCCCTTCAGAAATGAGGG + Intergenic
909436250 1:75646441-75646463 ATGAGAACCTTCAGAAATGAAGG + Intergenic
909463476 1:75945455-75945477 AAGTTAGCCTTCATAAATGAAGG + Intergenic
909598864 1:77440218-77440240 AAACTACCCTTCAGAAATGAGGG - Intronic
910251900 1:85206607-85206629 ATGTTGCCATTTTGAAATAATGG + Intergenic
910453174 1:87367777-87367799 ATGTTGCTCTTCAGAAAGTTGGG + Intergenic
910975267 1:92899874-92899896 AAGCTATCCTTCAGAAATGAGGG - Intronic
911473572 1:98348518-98348540 CTGTTGCCATTAAGAAATGGAGG - Intergenic
911667235 1:100567299-100567321 ATGTTGTCCTTCAGCCATAAAGG - Intergenic
911742122 1:101397951-101397973 ATGTTTCTATTTAGAAATGAAGG - Intergenic
912084811 1:105986083-105986105 TTGTTTCTCTTCAGAAATGCTGG + Intergenic
912145294 1:106786346-106786368 ATATGGCACTTAAGAAATGAGGG - Intergenic
912267845 1:108176775-108176797 AAAGTGTCCTTCAGAAATGAAGG + Intronic
912885819 1:113473184-113473206 AAGGTGTCCTTCAGAAATAAAGG - Intronic
913281831 1:117192297-117192319 AAACTGTCCTTCAGAAATGAAGG + Intronic
913375263 1:118144282-118144304 TTGGTGCCCTCCAGAAATGTGGG + Intronic
915071266 1:153270783-153270805 AATCTGCCCTTCAGAAATGAAGG - Intergenic
915193299 1:154170058-154170080 ATCTTGCCCTTCTGAAATCATGG + Intronic
915703012 1:157813984-157814006 AAGCTGTCTTTCAGAAATGAAGG + Intronic
915711266 1:157901343-157901365 AAATTGTCCTTCAAAAATGAAGG + Intergenic
915761932 1:158322739-158322761 AATATGTCCTTCAGAAATGAAGG - Intergenic
916130650 1:161608288-161608310 ATCCTGCCCTTCAGAGATGAAGG + Intronic
916364655 1:164011702-164011724 AATGTGTCCTTCAGAAATGATGG + Intergenic
916456694 1:164978261-164978283 ATGTTTCCCTGGGGAAATGAGGG - Intergenic
916795143 1:168160143-168160165 AAGCTATCCTTCAGAAATGAAGG - Intergenic
916943994 1:169705910-169705932 ATGTTACCCTGCATAAATGTTGG + Intronic
917039072 1:170782744-170782766 AAATTGTCATTCAGAAATGAAGG - Intergenic
917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG + Intergenic
918656296 1:187029944-187029966 AAGCTGTCCTTCAGAAGTGAAGG + Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
920602596 1:207344479-207344501 AAGTTATCCTTCATAAATGAAGG - Intronic
922050385 1:221983774-221983796 GTGTGGCCATTCAGAAAAGAAGG + Intergenic
922392884 1:225165087-225165109 AATTTGCCATTCAGATATGAGGG - Intronic
922690880 1:227689455-227689477 ATCTTGTCTTTCAAAAATGAAGG + Intergenic
922710056 1:227821576-227821598 ACATCGTCCTTCAGAAATGAGGG - Intronic
923061533 1:230479584-230479606 ATGTTGCCTGTCACAAGTGAAGG + Intergenic
923834653 1:237596902-237596924 AAGCTATCCTTCAGAAATGAAGG + Intronic
924068526 1:240252498-240252520 AAGTTACCCTCCATAAATGATGG - Intronic
1063081942 10:2775664-2775686 ATATTAACCTTGAGAAATGATGG - Intergenic
1064572751 10:16712936-16712958 AAGTTATCCTTCAGAAATGAAGG - Intronic
1065422071 10:25556191-25556213 ATTTTGGCCTTCATAAACGAGGG - Intronic
1065708047 10:28489284-28489306 AGGTTCCCCTTCAGGAATGAAGG + Intergenic
1067325822 10:45265504-45265526 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1067368607 10:45660818-45660840 ATATTATCCTTCAGAAATGAAGG + Intronic
1068000589 10:51329663-51329685 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1068888423 10:62122939-62122961 AAGTTAGCCTTCAGAAATGAAGG - Intergenic
1069012391 10:63388383-63388405 ATGTTATCCTTCATAAATGATGG + Intronic
1070177362 10:73982903-73982925 ATTTTACCTTTCAAAAATGAAGG - Intergenic
1070543677 10:77436024-77436046 AAATGGCCCTTAAGAAATGAAGG + Intronic
1071004753 10:80869992-80870014 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1072020758 10:91397278-91397300 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1072216597 10:93292439-93292461 ATGTTTCCATTCAGAAAGGCAGG + Intergenic
1072860885 10:99004882-99004904 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1074647379 10:115474197-115474219 ATGTTGCCCTTCAGAAATGAAGG - Intronic
1074747712 10:116551957-116551979 ATGATGGACTTCAGATATGATGG + Intronic
1074959262 10:118425288-118425310 TTGTTGGCCTTCATAAAAGAAGG + Intergenic
1075232812 10:120698155-120698177 AAGCTGTTCTTCAGAAATGAAGG - Intergenic
1076234292 10:128851748-128851770 CTTTCTCCCTTCAGAAATGAGGG - Intergenic
1076325058 10:129614670-129614692 ATGTTGCCCATGAGCAGTGAAGG + Intronic
1076941422 10:133612500-133612522 AATCTGTCCTTCAGAAATGAAGG + Intergenic
1077343393 11:2035894-2035916 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1079935617 11:26612736-26612758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1079980112 11:27142299-27142321 AAGCTGCCCTTCAGAAATAAAGG + Intergenic
1080318049 11:30972367-30972389 AAGTTACCCTTCATTAATGAAGG + Intronic
1081985796 11:47303065-47303087 AAGTTGTGCTTCAGAAATGAAGG - Intronic
1082644431 11:55703726-55703748 AGCTATCCCTTCAGAAATGAAGG + Intergenic
1082911257 11:58377204-58377226 AAGTTATCCTTCAGAAATGAAGG + Intergenic
1082917431 11:58452790-58452812 AAGTTGTCCTTTAGAAATGAAGG + Intergenic
1083040697 11:59682609-59682631 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1084471220 11:69360409-69360431 AAATTGCCCTTCAGAAAGGTTGG + Intronic
1086794227 11:91080782-91080804 TTTTTCTCCTTCAGAAATGACGG - Intergenic
1086829448 11:91541656-91541678 AAGCTGTACTTCAGAAATGAGGG + Intergenic
1086880210 11:92145013-92145035 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1087700150 11:101428093-101428115 AAATTATCCTTCAGAAATGAAGG - Intergenic
1088419848 11:109634160-109634182 AAGTTGTTCTTCAGAAATAAAGG - Intergenic
1089099456 11:115949798-115949820 AGGTAGTCATTCAGAAATGAAGG - Intergenic
1089569863 11:119398461-119398483 AAGCTACTCTTCAGAAATGAAGG + Intergenic
1090157054 11:124449787-124449809 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1090317035 11:125802050-125802072 AAACTGTCCTTCAGAAATGAAGG - Intergenic
1090407144 11:126483310-126483332 ATGTGAGCTTTCAGAAATGAAGG - Intronic
1090705049 11:129328424-129328446 ATTTTGCCCTTCATCTATGAGGG - Intergenic
1090911785 11:131127502-131127524 AAGTTGCTCTTCATAAATGAAGG - Intergenic
1091011702 11:132007259-132007281 ATGTTCACCTTCAAAAATAAAGG - Intronic
1091083954 11:132702294-132702316 AAATTGTCTTTCAGAAATGAAGG - Intronic
1091370505 11:135053726-135053748 AAACTGCCCTTCAAAAATGATGG - Intergenic
1202826379 11_KI270721v1_random:91083-91105 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1092313550 12:7384694-7384716 AAGTTACCCTTCAAAAATGAAGG + Intronic
1092504650 12:9084092-9084114 AAGCTGTCTTTCAGAAATGAGGG + Intronic
1092568113 12:9690263-9690285 AAGTTGTCCTTCAAGAATGAAGG + Intronic
1092985676 12:13843752-13843774 ATGTTGGACTTCACAAATGATGG - Intronic
1093339349 12:17951888-17951910 AAGCTGGCCTTCAGAAATGAAGG + Intergenic
1093339440 12:17953784-17953806 AAGCTGGCCTTCAGAAATGAAGG - Intergenic
1093383496 12:18522471-18522493 AAGTTGTCCTTCAGAAATGAGGG - Intronic
1093571916 12:20676313-20676335 AAGTTGTCCTTTATAAATGAAGG - Intronic
1094228057 12:28068735-28068757 GTGCTGTCCTTCAGAAATGAAGG + Intergenic
1094411062 12:30169530-30169552 ATGTTGCCCTCCAGACCTGTGGG - Intergenic
1094734011 12:33212181-33212203 AAGTTGTCTTTCAGAAATGAAGG + Intergenic
1095724031 12:45432845-45432867 ATATTGCCTCTCAGTAATGAAGG - Intronic
1095803148 12:46289701-46289723 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1096041873 12:48524340-48524362 ATGCTGTCATTCAGAAAGGAGGG - Intronic
1097629434 12:62042120-62042142 AGGATTCCCTTCAGATATGAAGG - Intronic
1097799416 12:63896775-63896797 ATGTTGCCTTAAAGAAAAGACGG - Intronic
1098178786 12:67822623-67822645 ATGTGGCTCTCCTGAAATGAAGG - Intergenic
1098207212 12:68124482-68124504 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1098591861 12:72223459-72223481 AAGTTGCCCTTGAGCAATTATGG - Intronic
1098613253 12:72487542-72487564 ATTTTGTCCTTCAGAAACTAAGG + Intronic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1102514997 12:113440414-113440436 ATCTTGCTCTTCAGAAAAGGAGG - Intergenic
1104463435 12:128972177-128972199 ATGCTGCCCTCCTGAAGTGATGG - Intronic
1106428105 13:29652927-29652949 AATTTGTCCTTCAAAAATGAAGG - Intergenic
1106755575 13:32820169-32820191 CTATTTGCCTTCAGAAATGAAGG + Intergenic
1107245919 13:38293617-38293639 AAATTGTCCTTCAAAAATGAAGG + Intergenic
1107592709 13:41925161-41925183 AAACTGCCCTTCAGAAATTAAGG + Intronic
1107981882 13:45741840-45741862 ATGTTTCTCTTCAATAATGAAGG - Intergenic
1108138080 13:47386564-47386586 ATCTTGCCATCCTGAAATGAAGG + Intergenic
1109583344 13:64368382-64368404 AAATGGCCCTTCAGGAATGAAGG + Intergenic
1109653285 13:65355705-65355727 AAGCTGTACTTCAGAAATGAAGG + Intergenic
1109807971 13:67469290-67469312 AAGTTATCCTTCATAAATGAAGG - Intergenic
1109842104 13:67932291-67932313 ATGTTGCAGTTCAAATATGAAGG - Intergenic
1109942348 13:69386516-69386538 AAGTCATCCTTCAGAAATGAGGG + Intergenic
1111003319 13:82214414-82214436 ATGCTGTCTTTCAGAAATGAAGG - Intergenic
1112060433 13:95734263-95734285 AAGTTATCCTTCATAAATGAAGG - Intronic
1112080214 13:95960934-95960956 AAGTTATCCTTCATAAATGAAGG + Intronic
1112452170 13:99522639-99522661 GTCTTGCCCTTGAGAAATGATGG + Intronic
1115082412 14:29472363-29472385 AAGCTACCCTTCAAAAATGAAGG - Intergenic
1115303500 14:31911364-31911386 AAGCTGTACTTCAGAAATGAGGG - Intergenic
1115382301 14:32754734-32754756 ATGATGTCCTTCAGAAATAAAGG - Intronic
1115540369 14:34413840-34413862 AAGCTGTCCTTCAGATATGAAGG + Intronic
1116685933 14:48038643-48038665 AAGTTATCCTTCACAAATGAAGG - Intergenic
1117345156 14:54824460-54824482 AAATTGTTCTTCAGAAATGAAGG + Intergenic
1117759531 14:59012726-59012748 ATATTACCCTTCATAAATGAAGG - Intergenic
1118291936 14:64534802-64534824 ATGTTGGCCTGAAGAAAAGATGG - Intergenic
1118520559 14:66578728-66578750 AAGTTGTCCCTCAGAAATGAAGG + Intronic
1118928344 14:70214853-70214875 AGGCTGCCCTTCAGAAAAGTTGG - Intergenic
1118964336 14:70565973-70565995 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1121297868 14:92844349-92844371 ATGTTTGCCTTCAGACACGAAGG - Intergenic
1121648573 14:95538144-95538166 ATTTTGCCCTCCAGAGACGAGGG + Intronic
1121784572 14:96647487-96647509 AAGTTGTCATTCATAAATGAAGG - Intergenic
1122011114 14:98748762-98748784 TTGTTGCCTTTGAGAAAGGAGGG + Intergenic
1122034392 14:98936771-98936793 ATGTTGCCCCATAGAAATCACGG - Intergenic
1124245200 15:28064035-28064057 AAACTGCCCTTCAAAAATGAGGG - Intronic
1125258102 15:37790062-37790084 ATGTTGCCCTTCAGAACTCTGGG + Intergenic
1125377702 15:39049735-39049757 AGGCTAGCCTTCAGAAATGAAGG + Intergenic
1125846953 15:42864647-42864669 AAATTATCCTTCAGAAATGAAGG + Intronic
1125980280 15:43994982-43995004 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1126480411 15:49112408-49112430 AAGTTATCCTTCATAAATGAAGG + Intronic
1126738238 15:51752331-51752353 CTGTTGACCTGCGGAAATGAAGG + Intronic
1127625094 15:60772668-60772690 CTGTTGCTCTACAGAAAAGATGG + Intronic
1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG + Intronic
1130218223 15:81993210-81993232 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1130692998 15:86102526-86102548 AAGTTATCCTTCATAAATGAAGG - Intergenic
1131018690 15:89079554-89079576 ATGCTGCCATTCAGAAGTCATGG - Intergenic
1131794187 15:95997188-95997210 AATTTGCCTTTGAGAAATGATGG - Intergenic
1132387995 15:101415371-101415393 CTGTTGCCATTAAGGAATGAGGG + Intronic
1132995084 16:2818538-2818560 AGGGTCCCCTGCAGAAATGAAGG - Intronic
1133375663 16:5284707-5284729 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
1134176346 16:12009804-12009826 ATTTTGCCCTCTAGAAATAATGG + Intronic
1135062772 16:19285197-19285219 TTGTTGCCCTGTAGAAATGAGGG + Intergenic
1137835543 16:51589020-51589042 ATCTGGCCCATCAGCAATGATGG - Intergenic
1137880733 16:52045337-52045359 AAGATGTCCTTCAGAAATGAAGG - Intronic
1138020700 16:53478028-53478050 AAGTTATCTTTCAGAAATGAAGG - Intronic
1138712398 16:58984288-58984310 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1139141695 16:64271313-64271335 AAGTAGTCCTTCAGAAGTGATGG + Intergenic
1140158341 16:72457465-72457487 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1140560924 16:75980635-75980657 AGTTTACCCTTCTGAAATGATGG + Intergenic
1140570626 16:76102488-76102510 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1143999841 17:11043114-11043136 ATGTTTCTCTCCAGAAATGGTGG + Intergenic
1144617500 17:16790006-16790028 CTGTTGCCCTGCAGGAATGTGGG - Intronic
1144895203 17:18525676-18525698 CTGTTGCCCTGCAGGAATGTGGG + Exonic
1145137020 17:20418555-20418577 CTGTTGCCCTGCAGGAATGTGGG - Intergenic
1145179388 17:20732405-20732427 ATATTGGCCAACAGAAATGATGG + Intergenic
1146576675 17:33999992-34000014 AAGCTGTCCTTGAGAAATGAAGG - Intronic
1146852311 17:36233302-36233324 ATGTTGGCCAACAGAAATGATGG - Intronic
1146868220 17:36357173-36357195 ATGTTGGCCAACAGAAATGATGG - Intronic
1147071094 17:37957791-37957813 ATGTTGGCCAACAGAAATGATGG - Intergenic
1147082621 17:38037317-38037339 ATGTTGGCCAACAGAAATGATGG - Intronic
1147098564 17:38161285-38161307 ATGTTGGCCAACAGAAATGATGG - Intergenic
1149113047 17:53057601-53057623 AAATTGTCCTTCAAAAATGAAGG + Intergenic
1149839100 17:59942382-59942404 ATGTTGGCCAACAGAAATGATGG + Intronic
1149943525 17:60897150-60897172 AAATTACCCTTCATAAATGAAGG - Intronic
1150080102 17:62230311-62230333 ATGTTGGCCAACAGAAATGATGG - Intergenic
1150897636 17:69232796-69232818 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1150916295 17:69440680-69440702 AAAATACCCTTCAGAAATGAAGG - Intronic
1151123979 17:71825156-71825178 ATGGGAGCCTTCAGAAATGAGGG - Intergenic
1154311577 18:13271133-13271155 ATTTTGCCATTCAGAAATGCTGG + Intronic
1155756177 18:29499222-29499244 AAGTTTTCCTTCAGATATGAAGG + Intergenic
1155762500 18:29585538-29585560 AAGTTGTTCTTCAGAAATAAAGG + Intergenic
1156432888 18:37094400-37094422 AAGTTATCCTTCAAAAATGAAGG + Intronic
1156594674 18:38534391-38534413 TATTTGTCCTTCAGAAATGAAGG + Intergenic
1156619854 18:38837113-38837135 AAATTGCCCTTCAAAAGTGAAGG + Intergenic
1157458055 18:47855569-47855591 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1157527776 18:48398144-48398166 ATGTTCCCCTTCTGAGTTGAGGG - Intronic
1157973902 18:52303351-52303373 TATCTGCCCTTCAGAAATGAAGG + Intergenic
1159747614 18:72257474-72257496 AAGTTTCCCCTCAGAAATGCAGG + Intergenic
1159821358 18:73149167-73149189 AAGTTATCCTTTAGAAATGAAGG - Intergenic
1159823754 18:73179090-73179112 AAGTTGTCTCTCAGAAATGAAGG + Intronic
1160976130 19:1793540-1793562 GTCTGGCCCTTGAGAAATGAGGG - Intronic
1162243350 19:9377006-9377028 AAAATGGCCTTCAGAAATGAAGG - Intronic
1162361607 19:10223854-10223876 GTGTTGCCCTCCAGAAACGTGGG + Exonic
1162622470 19:11854994-11855016 ATGCTGCCATTCATAAATGAAGG + Intronic
1164109396 19:22140610-22140632 CTGGTGCCCTCCAGAAGTGAAGG + Intergenic
1164569240 19:29358112-29358134 AAGTTGTCTTTCAAAAATGAGGG + Intergenic
1164946878 19:32302842-32302864 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1165017586 19:32892728-32892750 AAGTTATCCTTCATAAATGAAGG + Intronic
1165275886 19:34751220-34751242 TTGTGTTCCTTCAGAAATGAAGG - Intergenic
1167069526 19:47212320-47212342 ATGTCGGCCTTCATAAAAGAGGG + Intergenic
1167304453 19:48699140-48699162 ATGGGAGCCTTCAGAAATGAAGG + Intronic
925488659 2:4367478-4367500 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
925956919 2:8975587-8975609 ATGTTTCCCTTTAGGAAAGATGG - Intronic
926142229 2:10374596-10374618 ACCTTGCCCTCCAGAAATGCAGG + Intronic
926617582 2:15012801-15012823 AAACTACCCTTCAGAAATGAAGG + Intergenic
927073802 2:19556463-19556485 TTGCTGCTCTTCAGAAAGGAGGG - Intergenic
927352090 2:22127568-22127590 AAGCTGCCCTTCAGAAATGAAGG + Intergenic
928606689 2:32949453-32949475 CTGCTGCTCTTCAGAACTGATGG + Intronic
928849218 2:35722196-35722218 AAGCTATCCTTCAGAAATGAAGG + Intergenic
928910908 2:36419860-36419882 GTGGTGACATTCAGAAATGATGG + Intronic
929812511 2:45202589-45202611 AAGTTTCCCTTCAAAAATAAAGG + Intergenic
930294146 2:49532326-49532348 AAACTGCCCTTCAAAAATGAAGG + Intergenic
931505331 2:62920376-62920398 AAACTGCCCTTCAAAAATGAGGG + Intronic
931755553 2:65371043-65371065 GTGAGGGCCTTCAGAAATGAGGG + Intronic
933300354 2:80533667-80533689 ATGTTGACCTTCATATATGTGGG - Intronic
933361359 2:81290218-81290240 ATGCTGTCCTTCACAAATGAAGG - Intergenic
934128954 2:88927903-88927925 AGGTTGCTATTCAGAAAGGAAGG + Intergenic
934693140 2:96377387-96377409 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
935491417 2:103724928-103724950 AAGTTGTCCTTCACAAATGAAGG - Intergenic
935880531 2:107560290-107560312 TTGTTCTCCTTCACAAATGAAGG + Intergenic
937077221 2:119115979-119116001 ATATTGCCCTGAAGAAATGTGGG + Intergenic
938127268 2:128683645-128683667 AAGCTGCCCTCCAGAAATGTTGG - Intergenic
938395453 2:130943892-130943914 ACTTTGAACTTCAGAAATGAAGG - Intronic
938547065 2:132344039-132344061 ATGTTGCCAATCATATATGAGGG - Intergenic
938622880 2:133075394-133075416 CTGTGGAACTTCAGAAATGAGGG + Intronic
938673484 2:133606875-133606897 ATATTGCCCATCAGAAAATAAGG + Intergenic
938784538 2:134613666-134613688 AAATTGTCCTTCAAAAATGAAGG + Intronic
939065377 2:137477823-137477845 AAGTTACCCTTCATAAATGAAGG - Intronic
940091087 2:149918122-149918144 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
940786162 2:157983492-157983514 AAATTGCCCTTCAAACATGAAGG - Intronic
942518416 2:176777518-176777540 TTGTTGCCTTGCAGGAATGAAGG + Intergenic
943088012 2:183337756-183337778 AAACTGTCCTTCAGAAATGAGGG - Intergenic
943718673 2:191179929-191179951 ATGATTCCCTTGAGGAATGAGGG - Intergenic
944269117 2:197760996-197761018 AAGCTATCCTTCAGAAATGAAGG + Intronic
944763684 2:202842392-202842414 AAGTAGACCTCCAGAAATGATGG - Intronic
945202701 2:207298959-207298981 AGGCTGCCTTTCAAAAATGAAGG + Intergenic
945309372 2:208293521-208293543 ATGATACCCTTCAAAAGTGAAGG - Intronic
945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG + Intronic
945604448 2:211910981-211911003 ATGTTGCCAGGCAGAGATGATGG - Intronic
945746624 2:213726145-213726167 ATGTGGCAGTCCAGAAATGATGG + Intronic
945956345 2:216089701-216089723 ATCTTGCCCTTCCAAAATGCTGG + Intronic
946694154 2:222335204-222335226 AAGTTATCCTTCATAAATGAAGG + Intergenic
947043573 2:225951396-225951418 AAGTTACCCTTCATAAATAAAGG + Intergenic
947467705 2:230368214-230368236 AAGGTGTCCTTCAGAAATGAAGG - Intronic
947474323 2:230429189-230429211 AAGCTGTCCTTCAGAAGTGAAGG - Intronic
948511480 2:238468380-238468402 AAGATATCCTTCAGAAATGAAGG - Intergenic
948605758 2:239133773-239133795 AAGTGTCACTTCAGAAATGAGGG - Intronic
1168729958 20:67676-67698 ATGTTGCCTTTTATAAATTAGGG - Intergenic
1169412601 20:5384594-5384616 AAGTTATCCTTCATAAATGAAGG + Intergenic
1169913141 20:10663375-10663397 AGGTTGCCTTTCAGGACTGAGGG - Intronic
1170087184 20:12546876-12546898 AAGTTGATCTTCACAAATGAAGG - Intergenic
1170983607 20:21238258-21238280 ATGATGCCATACAGAAGTGAGGG - Intronic
1171117582 20:22538688-22538710 TTCTTGCTCATCAGAAATGATGG + Intergenic
1172505857 20:35462154-35462176 ATAGCGCCCTTCAGAGATGAGGG + Intronic
1173462187 20:43251904-43251926 ATGTAGCCCTTTAGGGATGAGGG + Intergenic
1173563681 20:44023847-44023869 AAGTTTCCCTGCAGAAGTGAGGG - Intronic
1173717060 20:45217646-45217668 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173719076 20:45237386-45237408 AAGTTGTCTTTCAGAAATGAAGG - Intergenic
1173769226 20:45643864-45643886 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173778384 20:45731808-45731830 ACATTATCCTTCAGAAATGAAGG - Intergenic
1174687842 20:52472608-52472630 ATTTTGCCATTGAGACATGAAGG - Intergenic
1176360584 21:5993633-5993655 AAGTTATCCTTCAGAAATGAGGG - Intergenic
1179762934 21:43544917-43544939 AAGTTATCCTTCAGAAATGAGGG + Intronic
1179930061 21:44562767-44562789 AAGTTGTCTTTCAGAAATGAAGG + Intronic
1180126653 21:45795571-45795593 ATGTTGCACGTCAAACATGAGGG + Intronic
1180638657 22:17280722-17280744 ATGTAGTGCTTCAGAAAGGAGGG + Intergenic
1181448358 22:22997840-22997862 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1182553443 22:31115146-31115168 ATTTTGCCCTTCAGAAAGCCAGG - Intronic
1182925809 22:34123627-34123649 ATGTTGGGGCTCAGAAATGAAGG + Intergenic
1184888590 22:47365525-47365547 AAGTTGTTCTTCAGAAATAAAGG - Intergenic
949162900 3:902197-902219 AAGCTGTCCTTCAGCAATGAAGG + Intergenic
949170871 3:994954-994976 ACCTTGCCCTTCAAAAATGCTGG + Intergenic
949793917 3:7824864-7824886 AAGTTATCCTTCAGAAATGAAGG + Intergenic
950260507 3:11540306-11540328 ATGTTCCCCATCAGAGATGCGGG - Intronic
950323773 3:12084428-12084450 ATCTTGTTCTTCAAAAATGAAGG + Intronic
951281978 3:20762278-20762300 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
951328352 3:21333287-21333309 AAGCTGACCTTCAGAAATGAGGG + Intergenic
952439409 3:33310702-33310724 AAGCTGTCCTTCAGAAATGAAGG - Intronic
952939871 3:38434470-38434492 AAGTTACCCTTCATAAATGAAGG + Intergenic
953857794 3:46514486-46514508 ATGAAGCCCATCAGAAGTGAAGG - Intergenic
954097952 3:48346010-48346032 ATGTTTCTCTCCAGAGATGATGG - Intergenic
955118739 3:56033615-56033637 AAGCTGTCCTTCAGAAATTAAGG - Intronic
955618920 3:60840144-60840166 AAGTGGCCCATCAGAAATGAAGG + Intronic
957570633 3:81943728-81943750 AAGTTGCCCTTCAGAAATCAAGG - Intergenic
957623982 3:82634506-82634528 ATGTTGCCTTTAAAAAATTAAGG + Intergenic
958571726 3:95892957-95892979 AACTTGTCCTTCAAAAATGAAGG - Intergenic
958678406 3:97294840-97294862 AAGTTATCCTTCATAAATGAAGG - Intronic
958695335 3:97520452-97520474 AAGTTATCCTTCATAAATGAAGG - Intronic
959393617 3:105807305-105807327 ATCTTGGCCTCCAGAAATGCTGG - Intronic
959528971 3:107410075-107410097 AATCTGCCCTTCAGAAATGAGGG + Intergenic
959880504 3:111439885-111439907 ATGTGTCCCTTCACAAAGGATGG - Intronic
960206834 3:114912174-114912196 AAGCTGTCCTTCAAAAATGAAGG + Intronic
960777386 3:121273249-121273271 AAATTGTTCTTCAGAAATGAAGG - Intronic
961599191 3:128045921-128045943 ATGGTGCCCTTCAGAGATAGAGG - Intergenic
962057917 3:131892333-131892355 ATGCTATTCTTCAGAAATGAAGG + Intronic
962823225 3:139073393-139073415 GTGTTCCCCTCCAAAAATGATGG + Intronic
963002252 3:140692979-140693001 TTGTTGCCCTTCTGAAATTATGG + Intronic
963012131 3:140780274-140780296 CTTAGGCCCTTCAGAAATGAAGG + Intergenic
963041718 3:141075085-141075107 ATGTTCCCCATCAGAAACAAGGG + Intronic
964247895 3:154674848-154674870 ATTATACCCTTCAAAAATGAAGG - Intergenic
964521076 3:157568014-157568036 AAGGTGTCCTTCAGAAATGAAGG - Intronic
965926143 3:173983169-173983191 GTGCTGCCCTTCAAATATGAAGG - Intronic
966025876 3:175280751-175280773 AGGAGGCCCTTCAGAAATGTTGG + Intronic
966284701 3:178280216-178280238 AAGTTATTCTTCAGAAATGAAGG + Intergenic
966346041 3:178981419-178981441 AAGTTATCCTTCATAAATGAAGG - Intergenic
967779630 3:193421318-193421340 AAGCTGTCCTTCAGAAGTGAAGG + Intronic
967944819 3:194795737-194795759 AAGTTATCCTTCATAAATGAAGG - Intergenic
968359864 3:198139347-198139369 GTGTTGCCATTCAGAAGTGTTGG - Intergenic
968543529 4:1181765-1181787 ATGTTGTCCTTCAGATATTTGGG + Intronic
969231085 4:5831781-5831803 ATGTTACCTTTAAGAAATGAAGG - Intronic
969901236 4:10351781-10351803 ATCCTGCCCTGAAGAAATGAGGG + Intergenic
969969574 4:11031966-11031988 ATTTTCCCCTTTACAAATGAGGG + Intergenic
970481210 4:16477363-16477385 ATGTAGCCCTTCAGGACTGGTGG + Intergenic
971597840 4:28554399-28554421 AGATTTCCCTTCAGAAATGAAGG - Intergenic
971703546 4:30011263-30011285 AAGTTATCCTTCATAAATGAAGG - Intergenic
972509037 4:39750407-39750429 ATGTTCCCAGACAGAAATGAAGG - Intronic
972902784 4:43705312-43705334 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
973579618 4:52330059-52330081 AAGCTGTCATTCAGAAATGAAGG - Intergenic
974464144 4:62231769-62231791 GTGTTGTCCATCAGGAATGATGG + Intergenic
975676957 4:76836720-76836742 GTGATGCCCTTCAGAAAGCATGG - Intergenic
975833535 4:78396470-78396492 AAGCTGTCATTCAGAAATGAAGG - Intronic
976040835 4:80882818-80882840 AAGCTATCCTTCAGAAATGAAGG + Intronic
977359286 4:95982352-95982374 AGGTTCCCCTTCAGAAATTGAGG - Intergenic
977398048 4:96496085-96496107 AAACTACCCTTCAGAAATGAAGG + Intergenic
977459102 4:97301724-97301746 AAGCTGTCCTTCAGAAATGAAGG + Intronic
977830184 4:101581443-101581465 AAGTTATCCTTCAGAAATAAAGG - Intronic
978081974 4:104604737-104604759 AAAATGTCCTTCAGAAATGAAGG - Intergenic
978117773 4:105042664-105042686 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
979283328 4:118892831-118892853 ATTTTGGCCTTATGAAATGAAGG - Intronic
979365906 4:119822962-119822984 AAGCTGTTCTTCAGAAATGAAGG + Intergenic
979488055 4:121291272-121291294 ACGCTGTCCTTTAGAAATGAAGG + Intergenic
979944571 4:126812773-126812795 ATTCTGACCTTCAGAAATTAGGG + Intergenic
980202255 4:129670793-129670815 CAGATCCCCTTCAGAAATGAAGG - Intergenic
980232528 4:130062787-130062809 TTGTTGTCCTTCCCAAATGAAGG - Intergenic
981988162 4:150883151-150883173 ATGGTGGCCTTCAAAAATTATGG + Intronic
983102842 4:163646290-163646312 AAGCTCTCCTTCAGAAATGAAGG + Intronic
983488797 4:168363207-168363229 AAGCTATCCTTCAGAAATGAAGG + Intronic
983666177 4:170187131-170187153 AAGTTGCCCTTCAGAATTGAAGG - Intergenic
983894689 4:173069495-173069517 AAGTTATCCCTCAGAAATGAAGG - Intergenic
984009878 4:174357913-174357935 CTATTGCCCTGTAGAAATGAAGG - Intergenic
984197221 4:176672697-176672719 ATATTGCCCTCCAGAAAATATGG - Intergenic
984343761 4:178492677-178492699 ATGCTGTCTTTCAGAAATGCAGG + Intergenic
984427504 4:179606824-179606846 TTTTTGCACTTGAGAAATGAGGG + Intergenic
985076954 4:186225209-186225231 AAGCTGTCCTTCAGAAAGGAAGG - Intronic
985562337 5:594956-594978 AGAATACCCTTCAGAAATGAAGG + Intergenic
986162035 5:5238958-5238980 GTGTTACCCTTCAAAAATGTAGG - Intronic
986465591 5:8019304-8019326 ACGTTTTTCTTCAGAAATGAGGG + Intergenic
986491830 5:8300669-8300691 ATGTTGTCTTTCAGTAATCAAGG - Intergenic
986552378 5:8972846-8972868 AAGTTATCCTTCAAAAATGAAGG - Intergenic
986870949 5:12045577-12045599 CTGTTGTCATTGAGAAATGAAGG + Intergenic
987713540 5:21535415-21535437 AAGATGTCCTTCTGAAATGAAGG + Intergenic
988642174 5:33051784-33051806 AAGTTGTCCTCCAGAAATGAAGG + Intergenic
989081634 5:37629012-37629034 AAGCTATCCTTCAGAAATGAAGG - Intronic
989148637 5:38274603-38274625 AAGCTGTCCTTCAGAAATGAAGG + Intronic
990180747 5:53157578-53157600 AGATTCCCCTTCAGGAATGAAGG - Intergenic
990396291 5:55383410-55383432 AAGTTACCTTTCAAAAATGAAGG - Intronic
990772490 5:59264892-59264914 CTGTTGTTCTTTAGAAATGATGG + Intronic
990928833 5:61062955-61062977 AAGCTGTTCTTCAGAAATGAAGG + Intronic
991224137 5:64249461-64249483 AAGCTGTCCTTCACAAATGAAGG + Intronic
991233666 5:64367115-64367137 AAGTTTTCCTTCAGAATTGAAGG + Intronic
992094487 5:73348998-73349020 ATGGTGCCCTTCAACACTGAGGG + Intergenic
993103728 5:83574184-83574206 ATGGTGCCCATCAACAATGAGGG + Intronic
993173666 5:84453645-84453667 ATGCTGTCATTCAGAAATGAAGG + Intergenic
993544803 5:89198473-89198495 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
993846571 5:92951902-92951924 AAGTTGCCATTCATAAATGAGGG - Intergenic
994589958 5:101760197-101760219 CTGTTGCCCTTCCCATATGAAGG + Intergenic
994879929 5:105477132-105477154 AAGTTGTCCTTCAGCGATGAAGG + Intergenic
995614530 5:113946191-113946213 AAGCTGTCCATCAGAAATGAAGG + Intergenic
996696356 5:126400690-126400712 AAGCTGTCCTTCAGAAATAAAGG - Intronic
997085980 5:130799244-130799266 AAGCTGTCCTTGAGAAATGAAGG + Intergenic
997415059 5:133721517-133721539 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
997827961 5:137124428-137124450 ATGTTGCCCTTCAGAATAGGAGG - Intronic
999475153 5:151891520-151891542 TAGTTGCCCTGCAGAAATGTAGG - Intronic
999549061 5:152664020-152664042 AAGATGTCCTTCAAAAATGAAGG + Intergenic
1000262999 5:159607338-159607360 AAAATGCCCTTCAAAAATGAAGG - Intergenic
1001964650 5:175901748-175901770 AGGTTCCCCTTCAGAAATAAAGG + Intergenic
1002084596 5:176765344-176765366 AAGTTATCCTTCAGAAGTGAAGG - Intergenic
1002663917 5:180809433-180809455 ATGTTGCGCTTTAGACAGGAGGG - Intronic
1002677023 5:180925552-180925574 AATCTGTCCTTCAGAAATGAGGG + Intronic
1002687192 5:181022382-181022404 AAGTTGTCCTTTAGAAATGAGGG + Intergenic
1002687201 5:181022508-181022530 AAGTTGTCCTTTAGAAATGAGGG - Intergenic
1002982745 6:2157857-2157879 ATTTTACCCTTGAGGAATGAAGG - Intronic
1003156536 6:3601696-3601718 AAGTTATCCTTCATAAATGAAGG - Intergenic
1004159953 6:13204482-13204504 AGGTTCCCCTCCAGAAATGTGGG + Intronic
1004161496 6:13218137-13218159 ATGTTTTTCTTTAGAAATGATGG + Intronic
1004165176 6:13250599-13250621 ATGTTGTCCTTAAGAAAGGAAGG + Intronic
1004749412 6:18546061-18546083 ATATTGTCCTACAAAAATGAAGG + Intergenic
1006224423 6:32524613-32524635 CGTTTGCCCTTTAGAAATGATGG + Intronic
1007140836 6:39571993-39572015 ATGTAGGAATTCAGAAATGAGGG - Intronic
1007695000 6:43726265-43726287 ATGTTGCCTTTCTGAAGTGCTGG - Intergenic
1007787309 6:44288084-44288106 ATGTTGCCTCTGAGAAATGAAGG + Intronic
1008020503 6:46572407-46572429 AAGCTGTCCTTCAAAAATGAAGG - Intronic
1008997631 6:57677061-57677083 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1009003179 6:57746482-57746504 AAGATGTCCTTCTGAAATGAAGG - Intergenic
1009186128 6:60576409-60576431 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1009663426 6:66645550-66645572 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1009688074 6:66989353-66989375 AAGCTGTCCTTCAGAAAGGAGGG - Intergenic
1010856383 6:80845691-80845713 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1011198475 6:84807570-84807592 ATGCTGCCCTTGACAAATCATGG - Intergenic
1011229333 6:85142336-85142358 AGTTTGTTCTTCAGAAATGATGG - Intergenic
1011500518 6:87983343-87983365 AAGCTATCCTTCAGAAATGATGG + Intergenic
1011522986 6:88230149-88230171 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1011788273 6:90869816-90869838 ATGGTGCCGTTCAGAATAGATGG + Intergenic
1012033917 6:94107635-94107657 AAGTAGCCCTTGAGAAATGTGGG + Intergenic
1012491709 6:99789364-99789386 GTGGCACCCTTCAGAAATGATGG + Intergenic
1012782131 6:103574955-103574977 ATTTCTCCCTTCAGAAATGAAGG - Intergenic
1013340672 6:109212377-109212399 AAGTTAACCTTCAGAAATGAAGG - Intergenic
1013923127 6:115434252-115434274 ATGTTGACCTTCAAAAGTGTAGG - Intergenic
1014173489 6:118305914-118305936 ACTTGACCCTTCAGAAATGAAGG - Intronic
1014688786 6:124535577-124535599 AGGTTGCCCTTAAGAAATACTGG + Intronic
1014932495 6:127350657-127350679 AGGCTGTCCTTCAGAAATGAAGG + Intergenic
1015327471 6:131939527-131939549 ATGTTCCACTTCAGCAATAAGGG - Intergenic
1015580904 6:134723897-134723919 TTGTTCCCCTTCAGAAGTCATGG + Intergenic
1016279749 6:142402075-142402097 ATTTTGTCCTTGAGAAATAAAGG - Intronic
1016531491 6:145062798-145062820 AAGCTACCCTTCAGAAAGGAAGG + Intergenic
1016793494 6:148091605-148091627 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1018350453 6:162953460-162953482 ATGTTGCCTTTCAGAAAAAAAGG - Intronic
1018986495 6:168641482-168641504 ACGTTGTCCTTGAGAAATGTAGG + Intronic
1019027540 6:168981509-168981531 AAACTGACCTTCAGAAATGAAGG + Intergenic
1019084296 6:169459860-169459882 AAGTTGCCCTTCAAAAGTAAGGG + Intronic
1019260127 7:77302-77324 GTGTTGCCGTTCAGAAGTGTTGG + Intergenic
1019801486 7:3091428-3091450 ACATGGCCCTGCAGAAATGAAGG + Intergenic
1020597555 7:10227743-10227765 ATGATCTCCTTCAAAAATGAAGG + Intergenic
1020781687 7:12524432-12524454 ATGTTACCTTTTAGAGATGAGGG + Intergenic
1021230427 7:18081063-18081085 AAGTTGTTCTTTAGAAATGAAGG - Intergenic
1021630814 7:22645488-22645510 AAGCTGACCTTCAGAAATGAAGG - Intergenic
1021656642 7:22880255-22880277 CTGATGCCCATCAGAAATGGGGG + Intergenic
1022661080 7:32367082-32367104 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1022985872 7:35652772-35652794 AAGTTATCCTTCATAAATGAAGG + Intronic
1023232353 7:38048480-38048502 AAGTTATCCTTCACAAATGAAGG - Intergenic
1023468638 7:40488704-40488726 ATGTTATCCTTCAGAAATAAAGG - Intronic
1023887491 7:44369980-44370002 AAGCTACCCTTTAGAAATGAGGG + Intergenic
1024451420 7:49548965-49548987 GTGTTTCCCTTCAGAATAGAGGG + Intergenic
1024453048 7:49570924-49570946 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1024703890 7:51936966-51936988 AAGTTGTCCTTGAGAAATGAAGG - Intergenic
1024811231 7:53214791-53214813 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1025249403 7:57342038-57342060 ATGTTGCTCTTCAGGAATCAAGG + Intergenic
1026885487 7:73940514-73940536 AAATTATCCTTCAGAAATGAAGG - Intergenic
1027350650 7:77307736-77307758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1028877453 7:95839807-95839829 AACCTGTCCTTCAGAAATGAAGG - Intronic
1030183476 7:106735689-106735711 AAACTGTCCTTCAGAAATGAGGG - Intergenic
1030255537 7:107506032-107506054 GTGTTGGCTTTCTGAAATGATGG + Intronic
1030701963 7:112649841-112649863 AAGTTGTCCTTGAGAAATGAAGG + Intergenic
1033728591 7:144148542-144148564 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1034026093 7:147706369-147706391 AAGTTGTCATTCATAAATGAAGG - Intronic
1035215206 7:157360877-157360899 ATGTTGACCTTCAGATCTGTTGG - Intronic
1035357803 7:158288913-158288935 AAGCTGTTCTTCAGAAATGAAGG - Intronic
1035490860 7:159276833-159276855 AAATTGTCCCTCAGAAATGAGGG - Intergenic
1035644190 8:1205846-1205868 ATTTTTCCCTTCAAAAATAAAGG + Intergenic
1035976501 8:4317936-4317958 ATGTTGCCGTTCCGAATTTAAGG + Intronic
1036061815 8:5331159-5331181 ATGCTTTCCTTCAGAAATGAAGG - Intergenic
1036790180 8:11712141-11712163 CTTTAGCCCTTCATAAATGATGG + Intronic
1036968867 8:13331607-13331629 ATGTTCTAATTCAGAAATGATGG + Intronic
1036998899 8:13694093-13694115 AAGCTGTCCTTCAGAAATTAAGG - Intergenic
1038391082 8:27201702-27201724 ATGTGGTCATTCAGCAATGATGG + Intergenic
1039267659 8:35843227-35843249 AGATTGTCCTTCAGAAATGAAGG + Intergenic
1041772968 8:61492493-61492515 ATGTGCACCTTCAGAAAGGATGG - Intronic
1041994416 8:64036335-64036357 AAGTTGTCCTTCAGCAATGAAGG + Intergenic
1042005931 8:64179830-64179852 AAGCTGTGCTTCAGAAATGAAGG + Intergenic
1042233341 8:66581848-66581870 AAGCTATCCTTCAGAAATGAGGG + Intronic
1042633479 8:70846202-70846224 AAGTTATCCTTCATAAATGAAGG + Intergenic
1043412803 8:80016453-80016475 AAGTTATCCTTCAAAAATGAAGG + Intronic
1044203520 8:89464364-89464386 ATTATGCCCTTTATAAATGAAGG - Intergenic
1044451551 8:92341377-92341399 AAATTGTCCTTCAGTAATGAGGG - Intergenic
1044765714 8:95572102-95572124 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1045120042 8:99027590-99027612 AAACTACCCTTCAGAAATGAAGG - Intronic
1045586349 8:103541383-103541405 AAGCTGTTCTTCAGAAATGAAGG + Intronic
1046880556 8:119302188-119302210 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1047265845 8:123308041-123308063 AAGCTGTCCTTCAAAAATGAGGG - Intergenic
1048035205 8:130671426-130671448 ATGTTGGCCTTGAAAATTGAAGG + Intergenic
1048329912 8:133464446-133464468 AGGCTGCACTTCAGAAATAAAGG + Intronic
1049663493 8:143831228-143831250 ATGTTGCCCATCAGTAAAAATGG - Intergenic
1049965813 9:778286-778308 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1050006648 9:1139140-1139162 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1050217592 9:3345111-3345133 ATGTTGCCCTTTATAAGGGAAGG + Intronic
1050609720 9:7339149-7339171 GTGTTCCCCTTCTGACATGATGG - Intergenic
1050960001 9:11717979-11718001 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1051207699 9:14705795-14705817 ATGCTGTCTTTCAAAAATGAAGG + Intergenic
1051443231 9:17110805-17110827 AGGCTACCCTTCAGAAATAAAGG - Intergenic
1051814206 9:21086768-21086790 AAGTTGACCTTCAGAAATGAGGG + Intergenic
1052072717 9:24102307-24102329 AAGTTATCCTTCAGAAATGTGGG + Intergenic
1052199623 9:25762761-25762783 AAGGTGTCCTTCAGAAACGAAGG + Intergenic
1053024890 9:34721167-34721189 ATGTTGTGGTTCAGAAGTGAAGG - Intergenic
1053181455 9:35974906-35974928 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1053863934 9:42415956-42415978 AATCTGCCCTTCAAAAATGAAGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1054872569 9:70061870-70061892 ATGCTGCCATTCAGAACTCATGG + Intronic
1055684034 9:78751456-78751478 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1056742699 9:89273565-89273587 AAGTTGTCTTTCATAAATGAAGG - Intergenic
1056994280 9:91442181-91442203 AAGCTGTCCTTAAGAAATGAAGG - Intergenic
1057539223 9:95949633-95949655 AAACTGCCCTTCAAAAATGAGGG + Intronic
1057582173 9:96296732-96296754 ATGTTGCCATTTAAAAATCAGGG + Intronic
1057932739 9:99210228-99210250 AAGCTGTCCTTCATAAATGAAGG - Intergenic
1058204708 9:102089244-102089266 AAATTACCCTTCAAAAATGAAGG + Intergenic
1058288319 9:103207385-103207407 TTCTTGGCATTCAGAAATGATGG + Intergenic
1058319694 9:103613736-103613758 AAGCAGTCCTTCAGAAATGAGGG - Intergenic
1058925560 9:109660081-109660103 ATGTTGGCCTTCCAAAATGCTGG + Intronic
1059073897 9:111168695-111168717 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1059363931 9:113770626-113770648 ATGGTGCCCTCCAGCAATGGTGG + Intergenic
1059568428 9:115407777-115407799 ATGATGCCCTCCAGACATGCTGG - Intergenic
1060223709 9:121778077-121778099 ATGTTAGACTTCAGAACTGAGGG - Intronic
1060641191 9:125240808-125240830 ACGTTCCCCTTCAGGAGTGAAGG + Exonic
1061106276 9:128533076-128533098 GTGCTGCCCTACAGAAATGAAGG - Intronic
1062692904 9:137853780-137853802 AAGTTATCCTTCAGAAATGAAGG - Intronic
1062727740 9:138085797-138085819 AAGCTATCCTTCAGAAATGAGGG + Intronic
1062744565 9:138203167-138203189 GTGTTGCCGTTCAGAAGTGTTGG - Intergenic
1186318794 X:8401182-8401204 ATGAGGGCCTTCATAAATGAAGG - Intergenic
1186645921 X:11507220-11507242 CTGTGACCCTTCAGAAATAAGGG + Intronic
1186713567 X:12226675-12226697 ATGTTGCCCTGTGGAAATGGGGG - Intronic
1187826585 X:23337174-23337196 AAGTTGCCCTTTAGATATGGAGG - Intronic
1188066437 X:25666467-25666489 AAAATACCCTTCAGAAATGAAGG - Intergenic
1188070463 X:25712140-25712162 GTATAGCCCTTCAGAACTGAAGG - Intergenic
1188138158 X:26514968-26514990 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1188393219 X:29646858-29646880 AAGCTGTCCTTCAGAAATGAAGG + Intronic
1188729947 X:33633675-33633697 AAGTTATCCTTCATAAATGAAGG + Intergenic
1188746069 X:33845996-33846018 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1189060213 X:37745777-37745799 ATGTGGCCTTTCAGGAATGTAGG + Intronic
1189078823 X:37947110-37947132 ATTTGGCCCCTCAGAAGTGAGGG - Intronic
1189257067 X:39648569-39648591 ATGGTGCTCAGCAGAAATGATGG + Intergenic
1190156146 X:47994306-47994328 AAGTTATCCTTCAGGAATGAAGG + Intronic
1190405889 X:50087148-50087170 ATTTTGCCCCTCAAAAATGATGG + Intronic
1190961354 X:55252165-55252187 AAGTTGTTCTTCAGAAATGAGGG - Intronic
1191022411 X:55876945-55876967 AAGCTGCCTTTCAGAAATAAAGG - Intergenic
1191591164 X:62887040-62887062 AAGCTAACCTTCAGAAATGAAGG - Intergenic
1191700486 X:64036774-64036796 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1192383187 X:70638388-70638410 AAGCTATCCTTCAGAAATGAAGG + Intronic
1192715210 X:73633269-73633291 AAGCTGTCCTTTAGAAATGAAGG - Intronic
1193071559 X:77311235-77311257 ATGTTACCCTTCAATAATGTAGG + Intergenic
1194020666 X:88688094-88688116 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1194440976 X:93933627-93933649 ATATTGCCCTACAGCAATGTTGG - Intergenic
1194877689 X:99209276-99209298 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1195019592 X:100813126-100813148 AAACTGCCCTTCAGAAATGAGGG + Intergenic
1195147060 X:102028632-102028654 AAGTTACCCTTCAAAAATAAAGG + Intergenic
1195482860 X:105367984-105368006 ATCTTGTCCTTCAAAAATGAAGG - Intronic
1195639957 X:107162611-107162633 AAAATGTCCTTCAGAAATGAAGG + Intronic
1195816943 X:108898024-108898046 ACACTGTCCTTCAGAAATGAAGG + Intergenic
1196126544 X:112107549-112107571 AAGCTGGCATTCAGAAATGAAGG - Intergenic
1196289914 X:113928189-113928211 AAATTACCCTTCACAAATGAAGG - Intergenic
1196549884 X:117011358-117011380 ATGTTTCCCTGGGGAAATGAGGG - Intergenic
1196864997 X:120063049-120063071 AAGCTACCTTTCAGAAATGAAGG + Intergenic
1196878104 X:120173283-120173305 AAGCTACCTTTCAGAAATGAAGG - Intergenic
1197167107 X:123390360-123390382 AAGTTGCCTTTCATAAATGAAGG - Intronic
1197682032 X:129395433-129395455 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1198127889 X:133664649-133664671 ATGTTATGCTTGAGAAATGAGGG + Intronic
1198192131 X:134317660-134317682 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
1198433762 X:136594527-136594549 ATATGGACCTTCAGAAAGGAAGG - Intergenic
1199003404 X:142668005-142668027 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1199218430 X:145288943-145288965 AAGGTGTCCTTCAGAAATGAAGG - Intergenic
1200295995 X:154921073-154921095 ATTTTATCTTTCAGAAATGAAGG - Intronic