ID: 1074649335 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:115501380-115501402 |
| Sequence | CAGGTTATGAACCCTGTTAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074649332_1074649335 | 9 | Left | 1074649332 | 10:115501348-115501370 | CCTATTAGAAAGTGACATTATTT | 0: 1 1: 20 2: 206 3: 460 4: 670 |
||
| Right | 1074649335 | 10:115501380-115501402 | CAGGTTATGAACCCTGTTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074649335 | Original CRISPR | CAGGTTATGAACCCTGTTAC AGG | Intronic | ||
| No off target data available for this crispr | |||||