ID: 1074649335

View in Genome Browser
Species Human (GRCh38)
Location 10:115501380-115501402
Sequence CAGGTTATGAACCCTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074649332_1074649335 9 Left 1074649332 10:115501348-115501370 CCTATTAGAAAGTGACATTATTT 0: 1
1: 20
2: 206
3: 460
4: 670
Right 1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074649335 Original CRISPR CAGGTTATGAACCCTGTTAC AGG Intronic
No off target data available for this crispr