ID: 1074651098

View in Genome Browser
Species Human (GRCh38)
Location 10:115525309-115525331
Sequence CATAATTAGATCAACAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074651098_1074651102 1 Left 1074651098 10:115525309-115525331 CCAATCTTGTTGATCTAATTATG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1074651102 10:115525333-115525355 TAATTGTGGTTTCTGGATTCTGG No data
1074651098_1074651101 -6 Left 1074651098 10:115525309-115525331 CCAATCTTGTTGATCTAATTATG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1074651101 10:115525326-115525348 ATTATGGTAATTGTGGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074651098 Original CRISPR CATAATTAGATCAACAAGAT TGG (reversed) Intronic
901387983 1:8923690-8923712 CATAATTGGATCAACAAGGGAGG - Intergenic
901434954 1:9241711-9241733 CTTAATTAGATCACGAAGTTAGG + Intronic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
908841750 1:68287210-68287232 CCTGATTAAATCAACAAGTTGGG - Intergenic
909153876 1:72045074-72045096 CAAAATTATATAGACAAGATAGG - Intronic
909316204 1:74222937-74222959 CAAAATTAAATAAACAAGTTTGG - Intronic
910347702 1:86259403-86259425 CATAATTAGGTCTACAAGGTGGG + Intergenic
910462452 1:87462956-87462978 AAAAAATAGATCAACAAAATTGG - Intergenic
918013864 1:180613725-180613747 CATAATAAAATCAACATGAAGGG - Intergenic
918388084 1:184030999-184031021 CATAACTGGAACAACAGGATTGG + Intronic
919064053 1:192670447-192670469 CATATTTAGATCAATAATAATGG - Intergenic
919145461 1:193629072-193629094 TATAGTTTTATCAACAAGATGGG - Intergenic
921470275 1:215539830-215539852 AATAATTAGATCAAGAAAAAGGG - Intergenic
921644722 1:217600371-217600393 CATAATGAAATCATCTAGATAGG - Intronic
924015538 1:239717265-239717287 CATAATTAAGTCAACAAAACTGG - Intronic
924478238 1:244400811-244400833 CATAAGTAGATAAACAAAAGTGG - Intergenic
1063784319 10:9363426-9363448 CATAAGTAGATCAATAAGTTGGG + Intergenic
1064021560 10:11813400-11813422 CATAAAGAGTTCAGCAAGATGGG - Intergenic
1064241948 10:13638679-13638701 CCTGAATAGATCAAAAAGATGGG - Intronic
1065118159 10:22502230-22502252 AATAATTAAATAACCAAGATTGG - Intergenic
1066410046 10:35159124-35159146 AATGATTAGAACAACAATATTGG + Intronic
1068164280 10:53307678-53307700 TATAAATGGAGCAACAAGATAGG - Intergenic
1068509491 10:57946233-57946255 CATAATTGAATAAACATGATAGG + Intergenic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1071262171 10:83930263-83930285 CATTATTAGATCACCAAAAGGGG + Intergenic
1074651098 10:115525309-115525331 CATAATTAGATCAACAAGATTGG - Intronic
1079392238 11:20032538-20032560 CATAATTTGATGAAGAAGAAAGG - Intronic
1079597215 11:22264807-22264829 AATAATGAGTACAACAAGATGGG + Intronic
1084513790 11:69623932-69623954 CACAATTAGAACAACAGCATTGG + Intergenic
1087525290 11:99302291-99302313 GATGAAAAGATCAACAAGATGGG + Intronic
1087572700 11:99949949-99949971 CATAATTATGTCACCAAGACAGG - Intronic
1087960800 11:104346506-104346528 CAAAATTATATAAGCAAGATTGG + Intergenic
1092447293 12:8568862-8568884 CATCAATAGATCAAGAAAATGGG + Intergenic
1092570605 12:9717112-9717134 GAAAATTAGTTCAACAAGACTGG + Intronic
1092932098 12:13325698-13325720 CATAATTTTATCACCAAAATGGG + Intergenic
1093640078 12:21517205-21517227 CTTATTTAGATGAGCAAGATTGG - Exonic
1093872730 12:24311466-24311488 CAAAATTAGTTCAACAAACTTGG - Intergenic
1095436519 12:42194635-42194657 CATAATTAGATATATAAGAATGG - Intronic
1095906048 12:47379314-47379336 GATAAATGGATCAACAAAATGGG - Intergenic
1097359509 12:58643015-58643037 CATAATTGTATCAAACAGATTGG - Intronic
1097390366 12:59004656-59004678 GCTAATTAAATCAACATGATGGG + Intergenic
1097414131 12:59293458-59293480 TATAATAAGATTAAGAAGATAGG + Intergenic
1097925104 12:65118576-65118598 CATCATTAGATCATCCACATAGG + Intronic
1101768933 12:107730472-107730494 CATATTTATATCCACAAGTTAGG - Intergenic
1101943704 12:109119929-109119951 CTTAATTAGTTCAACAGGAGTGG - Intronic
1102790499 12:115640424-115640446 CATAATTACAATAACAAGAAGGG + Intergenic
1103071149 12:117943588-117943610 GATTAATAGATCAACAAAATGGG + Intronic
1106254342 13:28009189-28009211 CATAATCAGTCCAACAAAATGGG - Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1110333551 13:74300364-74300386 CATAATAACATGAACAAGAATGG + Intergenic
1111505012 13:89176740-89176762 CATAATTAGAGCATCAAAATTGG + Intergenic
1111730092 13:92063972-92063994 CATAATTAAATGAACAAATTTGG + Intronic
1113443213 13:110345958-110345980 CATGATGACATCAAGAAGATGGG + Intronic
1115271179 14:31555137-31555159 AATAAATGAATCAACAAGATTGG + Intronic
1115759393 14:36563066-36563088 CATTTTAAGATCAACAAGAGGGG + Intergenic
1116338516 14:43691359-43691381 CATATTTTGATCTACAGGATAGG + Intergenic
1123785042 15:23663148-23663170 AATAAATAAATAAACAAGATTGG - Intergenic
1126625384 15:50681463-50681485 CATAATTAGACTAGAAAGATAGG - Intronic
1127641178 15:60917256-60917278 AATAATTATATTAACCAGATGGG - Intronic
1127743144 15:61934318-61934340 CACCATTAGAACAAGAAGATTGG - Exonic
1130178671 15:81603221-81603243 GATAATGAAATCAACAAGAGAGG + Intergenic
1131888150 15:96942522-96942544 CATAACTATATTAACAAAATAGG + Intergenic
1133184615 16:4086625-4086647 CATAATTAGCTCAAAAAAATTGG + Intronic
1138290620 16:55843508-55843530 CATAATTTGATGAGCAACATTGG - Intergenic
1138323479 16:56139831-56139853 TATAATAAGATAAATAAGATAGG + Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1148006268 17:44432836-44432858 AATATTTTGATCAATAAGATGGG + Intronic
1149149330 17:53541167-53541189 CTTAAGTAGATCTACAAGAATGG - Intergenic
1149153487 17:53597255-53597277 GATAATGAGATCAAAGAGATTGG - Intergenic
1151841364 17:76620390-76620412 AATAATGAAATCAACAGGATGGG - Intergenic
1156016903 18:32556636-32556658 CAAAATTAAAACAATAAGATGGG - Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
926924402 2:17972488-17972510 CATCATTAGATCAAACAGTTGGG + Intronic
929715717 2:44307219-44307241 CATGATCAGATAAACAAAATGGG - Intronic
939253088 2:139708432-139708454 CACAGTTATATCAAAAAGATTGG - Intergenic
939300705 2:140333766-140333788 CAAAGTTAGATGTACAAGATGGG + Intronic
939835147 2:147120858-147120880 CATAACTAGACCAAAAACATGGG - Intergenic
940447420 2:153792514-153792536 AATAATTAAATCAAGAGGATTGG - Intergenic
941175347 2:162191666-162191688 CATAATTTAATCAGCAATATGGG - Intronic
942402770 2:175621186-175621208 CATAATTAGATCAATCTGAAAGG + Intergenic
943144277 2:184021937-184021959 TATAATGATATCAACAATATAGG - Intergenic
945400158 2:209372087-209372109 CATAATTAAAAGAACCAGATAGG + Intergenic
946915088 2:224510856-224510878 CATACTTAGATAAATTAGATTGG - Intronic
948339345 2:237237037-237237059 CACCATTAGAACAACATGATAGG + Intergenic
1169481934 20:5990477-5990499 CATAATGAGATCAACTGGAGAGG - Intronic
1170028483 20:11917936-11917958 CTGAATTAGGTCAGCAAGATGGG - Exonic
1170534241 20:17324482-17324504 CAGAATCAGATTAGCAAGATGGG + Intronic
1170871904 20:20213707-20213729 CATAATTACATGAAACAGATGGG - Intronic
1171260658 20:23729536-23729558 GAGAATTAGATCAACAACTTTGG - Intergenic
1171269777 20:23805383-23805405 GAGAATTAGATCAACAACTTTGG - Intergenic
1175035211 20:55993926-55993948 CATCATTAGATCAACCAATTTGG + Intergenic
1177384361 21:20389579-20389601 CATATTTGGTTTAACAAGATTGG + Intergenic
1184906723 22:47492761-47492783 TATAATGAGAAAAACAAGATGGG - Intergenic
950989329 3:17415668-17415690 CATAATTAGATTAATAATAAAGG + Intronic
952371291 3:32725201-32725223 CAAAATTAGAGTAACAAAATAGG + Intronic
954203282 3:49038397-49038419 AATAATTAAATCAACAAAAAAGG - Intronic
957247043 3:77728850-77728872 TATAATAACATCAACAAAATAGG - Intergenic
958560017 3:95736238-95736260 GAGAAGTAGATCAACAAAATAGG - Intergenic
958953480 3:100441393-100441415 CATAATTATTTCAAAAAGTTTGG + Intronic
959066272 3:101660233-101660255 AATATTTATATCAACAAGGTTGG + Intronic
960187405 3:114660697-114660719 CATAATCAGCACAACAAGACAGG + Intronic
961618459 3:128203782-128203804 AATTATTAAATCAATAAGATAGG - Intronic
964129830 3:153274058-153274080 CATTATTAGAGAAATAAGATAGG - Intergenic
965356468 3:167680330-167680352 TAAAATTAGATCAACAAGAATGG + Intergenic
965696929 3:171418725-171418747 GATGAATAGATAAACAAGATTGG + Intronic
965707488 3:171523880-171523902 CATTATAAGGTCATCAAGATGGG + Intergenic
969927643 4:10600165-10600187 AATAATTAGATCAATGATATGGG - Intronic
970473305 4:16397927-16397949 CAGAATTAGAAGAACAAGTTTGG + Intergenic
974221074 4:58971971-58971993 CATATTCAGCTCAACAAAATGGG + Intergenic
979000101 4:115206687-115206709 AATAATTAGAACAAAAAGATAGG - Intergenic
980372353 4:131892559-131892581 AATAATTACTTCAACAAGAAGGG + Intergenic
980524738 4:133975110-133975132 GAAAATTGGATCAACAAAATGGG + Intergenic
980596367 4:134960826-134960848 CATAATCATTTCAACTAGATAGG - Intergenic
980674291 4:136054543-136054565 CATAATTAGAGCAAGAAATTTGG + Intergenic
983797796 4:171886896-171886918 TATAAGTAGTTCAACATGATTGG + Intronic
990946500 5:61254843-61254865 CTTAATCAAATCAACAAGAATGG + Intergenic
991500648 5:67273225-67273247 CATAATTAAATCTACAAAACAGG - Intergenic
991946691 5:71904721-71904743 GATAATTATCTCAGCAAGATGGG + Intergenic
994257121 5:97610896-97610918 AATAATTAGATCATCAACATAGG + Intergenic
995590220 5:113692060-113692082 CCTAATTAATTCAACAAAATAGG - Intergenic
996106374 5:119509071-119509093 CATAACTAGTTAACCAAGATAGG - Intronic
1003649034 6:7941279-7941301 GATAATCAGATCACAAAGATGGG - Intronic
1005129412 6:22487879-22487901 TATAATTAGAACAAAAAGATTGG + Intergenic
1006912633 6:37573398-37573420 CATAAAAAGATGAAAAAGATTGG - Intergenic
1008209777 6:48706294-48706316 AATAATAATATCCACAAGATAGG - Intergenic
1008837589 6:55855095-55855117 CATAAATAGGTAAACAATATTGG - Intronic
1009733225 6:67636994-67637016 CAAAACCAGATCATCAAGATTGG + Intergenic
1010456437 6:76061580-76061602 TATTATTAGTTCACCAAGATAGG - Intronic
1011491016 6:87892499-87892521 CATTTTTAGAAAAACAAGATGGG + Intergenic
1012032974 6:94096792-94096814 CACTAATAGATAAACAAGATGGG + Intergenic
1013761681 6:113525992-113526014 CATAATTAGATTACAGAGATGGG + Intergenic
1014108185 6:117590790-117590812 AATAACTAGATCAAAATGATTGG + Intronic
1014127925 6:117798587-117798609 GATGATTAGCTTAACAAGATGGG + Intergenic
1016276019 6:142353330-142353352 CATAATTAGAATAACATCATGGG - Intronic
1025017165 7:55449109-55449131 CATAATTAGATAAAAAATAAAGG + Intronic
1026456653 7:70578510-70578532 AATAATTACTTCAGCAAGATGGG - Intronic
1027806420 7:82830701-82830723 CATAATTTGTTTAACAAGATGGG + Intronic
1028853053 7:95558139-95558161 CATAATAAGCACAACAAAATGGG - Intergenic
1029044224 7:97610827-97610849 AATAATTAGATTAACAAATTAGG + Intergenic
1029957887 7:104658968-104658990 CTTTATTAGATCCTCAAGATTGG + Intronic
1031096823 7:117430103-117430125 GATGATTGGATAAACAAGATTGG + Intergenic
1033081380 7:138301613-138301635 CAGAATGACATCAGCAAGATGGG - Intergenic
1033145334 7:138866203-138866225 CATGAGTAGATCAAGAAGGTCGG + Intronic
1033980598 7:147160314-147160336 CATAATTTGATAAACAAATTTGG - Intronic
1037157024 8:15714331-15714353 CATAATAACTTCAACAAAATTGG - Intronic
1037668174 8:20990154-20990176 AATAATTCGATCAAAAAAATTGG - Intergenic
1038219704 8:25595591-25595613 CTAAATTAAATCACCAAGATTGG + Intergenic
1039123806 8:34177780-34177802 CAGCATTAGGTCATCAAGATAGG + Intergenic
1041348076 8:56921955-56921977 CATAATCTGAGCAACAAGAAAGG + Intergenic
1043174653 8:77009912-77009934 CATAATTACATCCATAAGAGAGG + Intergenic
1043319449 8:78964749-78964771 CAGCATTAAATCAAGAAGATGGG - Intergenic
1044422647 8:92015722-92015744 CAAAATTATATTAAAAAGATGGG - Intronic
1044733121 8:95248582-95248604 AATAATTAAATCAACAAGTAGGG + Intronic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1045801841 8:106110864-106110886 CAAAATTATACCAACAAGAAAGG + Intergenic
1046125006 8:109895052-109895074 GATAATTAGGTCATCAAGAAGGG - Intergenic
1050365737 9:4872131-4872153 AATAATTACATAACCAAGATAGG - Intronic
1050954061 9:11632447-11632469 CATAATTTGATCAACATATTTGG + Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1053637087 9:40020409-40020431 AATAATTACTTCAACAAGAAGGG + Intergenic
1053768944 9:41444515-41444537 AATAATTACTTCAACAAGAAGGG - Intergenic
1054317917 9:63617253-63617275 AATAATTACTTCAACAAGAAGGG + Intergenic
1054547612 9:66355989-66356011 AATAATTACTTCAACAAGAAGGG - Intergenic
1055638773 9:78303153-78303175 CATTATTACATTAACAAAATTGG + Intronic
1056418322 9:86399370-86399392 TAAAATTAAATCAACAAGAATGG - Intergenic
1057486434 9:95488291-95488313 CATCATTAGAGCAAAGAGATGGG - Intronic
1058145321 9:101404192-101404214 AATAAATAGGTCAACAGGATAGG - Intronic
1058379279 9:104360877-104360899 AATAATTAGGGCAACAAAATAGG + Intergenic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1188583761 X:31748044-31748066 CATAAATAAATCAACACTATTGG + Intronic
1188685919 X:33070019-33070041 GATAATTACATCAACAAAAATGG + Intronic
1191883816 X:65868809-65868831 CATCAATAGATAAACAAAATGGG + Intergenic
1193500046 X:82264065-82264087 CATAATTATATAAACAATGTGGG - Intergenic
1193860132 X:86654748-86654770 GATAATTAGATCTATAAAATGGG - Intronic
1196726683 X:118902080-118902102 GAAAATTAGATCAACAAAAATGG - Intergenic
1197344053 X:125310507-125310529 CATAATTACAGGAACAGGATAGG + Intergenic
1197581633 X:128291255-128291277 AATAATCAGATCAAAAAAATGGG + Intergenic