ID: 1074661526

View in Genome Browser
Species Human (GRCh38)
Location 10:115663982-115664004
Sequence AAGTGGGAGCTGTGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074661526_1074661532 0 Left 1074661526 10:115663982-115664004 CCATTTTCCCACAGCTCCCACTT 0: 1
1: 0
2: 6
3: 46
4: 491
Right 1074661532 10:115664005-115664027 TACCTGAGTTTTGTCCTGGACGG No data
1074661526_1074661531 -4 Left 1074661526 10:115663982-115664004 CCATTTTCCCACAGCTCCCACTT 0: 1
1: 0
2: 6
3: 46
4: 491
Right 1074661531 10:115664001-115664023 ACTTTACCTGAGTTTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074661526 Original CRISPR AAGTGGGAGCTGTGGGAAAA TGG (reversed) Intronic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
901324150 1:8356949-8356971 AAGGGCAAGCTGTGGGAAATCGG - Intronic
901657220 1:10776414-10776436 AAGAGGCAGCTGTGGAGAAAGGG - Intronic
904079108 1:27860954-27860976 AAGTGGGAGGTCGGGGATAAGGG - Intergenic
904756797 1:32772366-32772388 AAGAGGGAGCTGGCGGAGAATGG + Exonic
905242684 1:36591059-36591081 ACGTGGAAGCTGAGGGGAAACGG - Intergenic
905750398 1:40457572-40457594 AAGATGGAAGTGTGGGAAAAGGG - Intronic
905825519 1:41023486-41023508 AAGTGGGAGCTGTGGGGAAGAGG - Intergenic
906421121 1:45668128-45668150 CAGTCAGAGCTGTGGGAGAAAGG - Intronic
907047310 1:51307113-51307135 AAGTGGGAGATGTGGCAAGAAGG + Intronic
907291227 1:53414144-53414166 AGTTGGGAGCTGTGGGATATGGG - Intergenic
908163474 1:61434899-61434921 CACTTGGAACTGTGGGAAAAGGG + Intronic
908946015 1:69498141-69498163 CAGTGAGGGCTGTGGGAGAAAGG + Intergenic
908986121 1:70023923-70023945 AATTGGGAGTTGTGGCAAATAGG + Intronic
909458924 1:75885395-75885417 AGGTGGGAGGTGGAGGAAAAGGG - Intronic
910106389 1:83635592-83635614 AAGTGGCAACTGTGGGCAATTGG - Intergenic
911246512 1:95524502-95524524 AGGTGGGACCTTTGGGGAAATGG - Intergenic
912036878 1:105327334-105327356 AAGTGGGAGCAGTGGTGATATGG + Intergenic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
912539913 1:110407045-110407067 AAGTGGAAGCTGAGGGACATCGG + Intronic
912550187 1:110480316-110480338 GAGTGGGATCTGTGGGGAACAGG + Intergenic
912794033 1:112679814-112679836 ATGTTAGAGCTTTGGGAAAAGGG + Intronic
914409886 1:147416853-147416875 AAATGGGAGCAGTGGCATAATGG + Intergenic
914703143 1:150151084-150151106 AAGTGGGGGCTATGAGAAAACGG - Intronic
914879127 1:151534149-151534171 AGGTGTGACCTGTGGAAAAAGGG + Intronic
915480960 1:156184612-156184634 AAGGGGGAGATGTAGGAAATTGG - Intergenic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916792003 1:168133341-168133363 ACGTGGGATCTGTGGGTCAAAGG - Intronic
916875947 1:168969149-168969171 AATGGGGAGATGTAGGAAAAAGG + Intergenic
917193078 1:172439431-172439453 AAGTGGTAGCTGTGGGGAGAAGG - Intronic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
917911759 1:179655066-179655088 ACGTGGGTGCTCTGGGAAACAGG - Intronic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
921413012 1:214856546-214856568 AAGTGGGAGCTGGGGTACAGAGG + Intergenic
921546075 1:216476502-216476524 AAGGGAGGGCTGTGGGCAAAAGG + Intergenic
921964405 1:221072872-221072894 AAATGGGAGCTTTGGGAGATTGG - Intergenic
922192226 1:223329440-223329462 AAGTTAGAACTTTGGGAAAAGGG - Intronic
922216233 1:223522438-223522460 AAGTGGGATGTGTGGGGAAGGGG - Intergenic
922510324 1:226160741-226160763 AAGAGGGAGCTGTGGGTACAAGG - Intronic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923982859 1:239345287-239345309 AAATGGGAAATGTGGGGAAATGG + Intergenic
1062989422 10:1802068-1802090 AAATGGTACCTGAGGGAAAAAGG + Intergenic
1063109267 10:3020542-3020564 AAGTGAGCGCTGTGGGGAAGCGG - Intergenic
1063199148 10:3770807-3770829 GGGAGGGAGCTGTGGGAACAAGG - Intergenic
1063356534 10:5404712-5404734 AATTGTTTGCTGTGGGAAAAGGG + Intronic
1063494944 10:6498422-6498444 AAATGTGGGCTGTGGGAAGAAGG + Exonic
1063803419 10:9608788-9608810 TAGAGGGAGCTGTTGGCAAAGGG + Intergenic
1063817160 10:9788486-9788508 AAGAGGGAACTGTGGAGAAAAGG + Intergenic
1063904070 10:10765177-10765199 AAATGGGACCAGTGGGAAATGGG - Intergenic
1067061957 10:43082195-43082217 CAGGAGGAGCTGTGGGAACAAGG - Intronic
1067145078 10:43688863-43688885 AAATAGGAGCTGTGCGGAAACGG + Intergenic
1067335155 10:45355687-45355709 GATTGGGAGCTGAGGGGAAAGGG - Intergenic
1067658193 10:48213048-48213070 AAGTGGGAGCTGGGAGAATCTGG + Intronic
1068465474 10:57384424-57384446 AAGTGGAAACTGTGGGCAGAAGG - Intergenic
1068569513 10:58614036-58614058 AAGTGAGAGATTGGGGAAAAGGG - Intronic
1069422203 10:68256742-68256764 AAGTGAGAGTTGGGGGAAAGAGG + Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1070611610 10:77937228-77937250 AAGTGGGCCCTGGGGGAGAAGGG - Intergenic
1070813534 10:79310229-79310251 AAGTGGGATGTCTAGGAAAAGGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1073227886 10:101939291-101939313 AGGTGTGAGCTGTTGGTAAATGG - Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1074840295 10:117344725-117344747 AAATGAGAGCTGTGGGATGAGGG - Intronic
1074885732 10:117691730-117691752 AAATGGGAGCTTTGGGGACAAGG - Intergenic
1075427969 10:122356590-122356612 AACTGGGAGGCATGGGAAAAGGG + Intergenic
1076208674 10:128623478-128623500 AAGGTGCAGCTTTGGGAAAAGGG + Intergenic
1076808190 10:132870009-132870031 GAGCAGGTGCTGTGGGAAAATGG - Intronic
1077654750 11:4007829-4007851 TGGTGAGAGCTGTGGGAAAATGG + Intronic
1077905543 11:6530050-6530072 ATTTGGGAGTTGTGGGAAACTGG + Intronic
1077945189 11:6889719-6889741 AAGTGGATGCTGAGGGCAAAAGG + Intergenic
1078731903 11:13982665-13982687 AAGAGGGAGCTGGGTGAAGAGGG + Intronic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1079804524 11:24912466-24912488 AAGTTGGAGCTGTGTTATAATGG - Intronic
1080817097 11:35769106-35769128 AGGTGGAGGCTGTGGGAAACTGG - Intronic
1080926308 11:36760095-36760117 AATTGGGGGCTGAGGAAAAAAGG + Intergenic
1081145473 11:39557934-39557956 AACTGTGGGCTGTGGGAAACAGG + Intergenic
1081451720 11:43177307-43177329 AGGAGGGAGCTATGGGCAAAGGG - Intergenic
1081870044 11:46379282-46379304 AAATGGGAGGGGTGGGGAAAAGG - Intronic
1082566355 11:54683579-54683601 AAGTGGGAGCTGCAGATAAACGG - Intergenic
1083094902 11:60240835-60240857 AAATGGGGGCTGTAGGAGAATGG - Intronic
1085023371 11:73222615-73222637 AAGTGTGACCTGCTGGAAAAAGG - Intronic
1085307937 11:75498785-75498807 AAGTGACAGCTGTGAGAAAGGGG - Intronic
1085758759 11:79223819-79223841 TGGTGGGAGCAGTGGGAAAAAGG - Intronic
1085834829 11:79941923-79941945 AAGTGGGAGCTCTGGAGAAGTGG + Intergenic
1086111662 11:83205845-83205867 TAGTGGGAACTGTGGCAAACTGG - Intronic
1087225180 11:95591275-95591297 AAGTGGGAGATGTGATCAAACGG + Intergenic
1087815701 11:102656121-102656143 TAGTGGGAGATGGGGGATAAAGG - Intergenic
1088700309 11:112405673-112405695 AAGTCGGTGCTGTCAGAAAAAGG + Intergenic
1088907051 11:114162840-114162862 AAGAGCGAGCTGGGGGAAAGTGG - Intronic
1089175613 11:116546952-116546974 CAGAGGAAGATGTGGGAAAATGG + Intergenic
1089405546 11:118194409-118194431 AACTGGGTGCTGTGGGGGAAGGG + Exonic
1089780694 11:120871401-120871423 AAGAAGGAGCTGAGGGCAAAGGG + Intronic
1090446507 11:126769137-126769159 AGATGGGACCTGTGGGAAGAGGG - Intronic
1091723088 12:2827377-2827399 AGGTGGAAGCTGTGGGAAGTGGG - Intronic
1093992314 12:25604196-25604218 AAGTGAAAGCTGTAAGAAAAAGG - Intronic
1094596517 12:31871359-31871381 AAGTGGGCGCTGGGGGTGAAAGG - Intergenic
1096710931 12:53455004-53455026 AAGTGAGTGTAGTGGGAAAATGG + Intronic
1097691576 12:62739091-62739113 CAGTGGAAGCTGTGAGAAAATGG + Intronic
1097853742 12:64440124-64440146 AGATGGGGGCTGTGGGAAATGGG - Intronic
1098009050 12:66031120-66031142 AAGGGGGAGCAGAGGGGAAATGG - Intergenic
1100390582 12:94143085-94143107 AAGGGGGAGCAGTGGGGAAATGG + Intergenic
1100899611 12:99223177-99223199 AAATGGTAGCTGTAGGAAAGGGG - Intronic
1101050519 12:100858736-100858758 AATAGGAAGCTGAGGGAAAATGG - Intronic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101375635 12:104168956-104168978 AACTTGGAGCTGGGGGAAACTGG + Intergenic
1101909336 12:108850290-108850312 AGGAGGGAGCTGGGGGAAAAGGG + Intronic
1102291953 12:111708133-111708155 AAGCAGGAACTGTGGGAACAAGG - Intronic
1102688775 12:114744161-114744183 AAGGGGATCCTGTGGGAAAAGGG + Intergenic
1105323193 13:19346678-19346700 AAATGTGAGCAGTGGGAGAATGG - Intergenic
1105874196 13:24539187-24539209 AAATGTGAGCAGTGGGAGAATGG + Intergenic
1106992700 13:35441162-35441184 AAGTGTGAGATGATGGAAAATGG - Intronic
1107731094 13:43349893-43349915 AAGTGACAGCTGTGGGGACAGGG - Intronic
1108644424 13:52412285-52412307 AAGTGGAAGGTGTTGGGAAAAGG - Intergenic
1109100408 13:58177245-58177267 AAGTGGAAACTGTAGAAAAAAGG - Intergenic
1110528719 13:76571545-76571567 AAGTAGGAGGTGGGGGAAAAGGG - Intergenic
1110642397 13:77840709-77840731 AAGCTGGAGCAATGGGAAAATGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1112743799 13:102505012-102505034 AATCGGGGGCTGTGGGCAAAGGG + Intergenic
1113173209 13:107530041-107530063 AAGAGTGAGCTGTGGAAAGAAGG - Intronic
1113771896 13:112915537-112915559 AAGTAGTGGGTGTGGGAAAATGG - Intronic
1113931464 13:113971179-113971201 AAGGGGGTGTTGTGGGAAGAGGG - Intergenic
1114191329 14:20441482-20441504 AAGTGGGAACTGTGGCAAACTGG - Intergenic
1114485396 14:23058666-23058688 AAGTGGAACCTGTGGGAAAGAGG + Exonic
1115134835 14:30095848-30095870 CTGGGGGAGCTGTGAGAAAAGGG + Intronic
1116535269 14:46019666-46019688 AAGTGGTAACTGTGGTATAATGG - Intergenic
1116719093 14:48469790-48469812 AATTGGTTGGTGTGGGAAAAAGG + Intergenic
1117402790 14:55372697-55372719 AGGAAGGAGCTGTGGTAAAAAGG - Intronic
1118401520 14:65383927-65383949 AAGTTGGAGCCATGGGAAAGGGG + Intergenic
1119222678 14:72922164-72922186 AAGAGGGAGCCGTGGGTAATGGG - Intergenic
1119266215 14:73264542-73264564 AGGTGTGAGCTGTGAGGAAAAGG - Intronic
1119651756 14:76388883-76388905 ACTTGGGAGCTGTTGGAGAATGG - Intronic
1119866611 14:77980081-77980103 AAGTGGGGGCTGGAGGAGAAAGG - Intergenic
1120392046 14:83921413-83921435 AAGTGTGAGGGGTGGGGAAATGG + Intergenic
1121049819 14:90812976-90812998 AAGTGGGAGCTTTGGGAAGGAGG + Intronic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122459526 14:101883761-101883783 AGGAGGGAGCTGTGGGGAGAGGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123014955 14:105369171-105369193 AAGGGGGCGCTGTGGGCAGACGG + Intronic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1124624882 15:31302158-31302180 CAGTGGGAACTGTGGGACAGAGG + Intergenic
1125234676 15:37499206-37499228 AAGTGGGAGTTTTGTAAAAACGG + Intergenic
1125726526 15:41871123-41871145 GAGCAGGAGCTGTGGGAAGATGG - Intronic
1125759710 15:42088277-42088299 CAGTGGGTGCTGTGGGTGAAAGG + Intronic
1125769026 15:42152994-42153016 AAGTGGGTGCTGGTGGGAAAGGG + Intronic
1126977008 15:54194624-54194646 AAGTGCGAGATCTGGGTAAAAGG + Intronic
1127273786 15:57424425-57424447 GTGTGGGTTCTGTGGGAAAAAGG + Intronic
1127282250 15:57502315-57502337 GCCTGAGAGCTGTGGGAAAATGG + Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1129007211 15:72383921-72383943 AACTGGGTGCTGTGGGAATGGGG + Intergenic
1130092295 15:80831115-80831137 ATTTGGGAGGTGTGGGAAACGGG + Intronic
1130614231 15:85389209-85389231 AGGAGGGAGCTGTATGAAAAAGG - Intronic
1131129850 15:89891103-89891125 AAGTGGCAGCAGTGGGGAAGTGG + Intronic
1131157928 15:90086293-90086315 AGGTGGTAGGTGTGGGAAACAGG - Intronic
1131935699 15:97502039-97502061 AAGTGGTAACTATGGGTAAATGG - Intergenic
1132202000 15:99961386-99961408 AAGGGGGAGCATTTGGAAAATGG + Intergenic
1132977102 16:2716359-2716381 AAGTGGGGGCTGTGTGGAACTGG - Intronic
1133398906 16:5470358-5470380 AAGGGGCTGCAGTGGGAAAAGGG - Intergenic
1134059011 16:11187901-11187923 GAGTGGGAGCTGGGAGAGAAGGG + Intergenic
1134586773 16:15418322-15418344 AACTGGGAGCTGTTGGGAAGTGG - Intronic
1134821654 16:17251915-17251937 GAGTGGGAGTTGTGGGGACAGGG + Intronic
1135115573 16:19720361-19720383 AAGTGAAAGCTCTGGGGAAAAGG - Intronic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1135895393 16:26396431-26396453 AAGGGTGAGCTGTGGAAAGAAGG - Intergenic
1138161113 16:54755708-54755730 AATTAGGAGCTTTGCGAAAATGG + Intergenic
1139477762 16:67211200-67211222 AAGTGGGAGCTGGGGTTCAAAGG + Intronic
1140477838 16:75247841-75247863 AGGTGGGAGCTGGGAGAAAATGG + Intronic
1145786984 17:27600651-27600673 ATGTGGTAGCTGTGGTAACAGGG - Intronic
1146396357 17:32470758-32470780 TACTGGGAGATGTGGAAAAATGG + Intronic
1147566406 17:41538968-41538990 AAGGGGGAGATGAGGGAGAACGG + Intergenic
1147630968 17:41931320-41931342 AAGTGGGAACTGGTAGAAAATGG - Intronic
1148250831 17:46078471-46078493 AAGAGGGAGCTATGGGAGATGGG - Intronic
1148733089 17:49849781-49849803 AAGTGGCAGATGTTGGCAAAAGG - Intergenic
1149106613 17:52975063-52975085 TAGTGTGAGCAGTGGGGAAAAGG + Intergenic
1149156002 17:53630643-53630665 AAGGTTGTGCTGTGGGAAAAGGG - Intergenic
1150009514 17:61491096-61491118 AATTGGGAGCTGATCGAAAACGG + Intergenic
1150681818 17:67290734-67290756 AGGTGTGGGCTGTGGAAAAATGG + Intergenic
1150899785 17:69259547-69259569 GACTGGGAGCTATGGGAATAGGG + Intronic
1151328725 17:73394316-73394338 AAGAGGGAACTGTGGGGGAAAGG + Exonic
1151507949 17:74541728-74541750 AACAGGGAGCTGTGGGGACACGG + Exonic
1151509481 17:74549535-74549557 AACAGGGAGCTGTGGGGACACGG + Intergenic
1151604889 17:75130002-75130024 AAGGTGGAGCTCAGGGAAAATGG + Exonic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1151922079 17:77164470-77164492 AAGGGGGAGCGCTGGGAAAAAGG - Intronic
1152020925 17:77779868-77779890 AAGCGGGAGGGGTGGGAAATCGG - Intergenic
1153555847 18:6312487-6312509 AAGAGGAAGCTCTGGGCAAATGG - Intronic
1154027340 18:10720995-10721017 ATGTGGGACCTGAGGGAGAAAGG - Intronic
1154434879 18:14335601-14335623 AAGCGGGACCTGGGAGAAAAGGG - Intergenic
1154482962 18:14855341-14855363 AAGAGGGAAATGTGGGGAAAAGG - Intergenic
1155941800 18:31807728-31807750 AAGAGGGAAATGTGGGTAAATGG - Intergenic
1156263421 18:35465751-35465773 ACTTGGGAGATGGGGGAAAATGG + Intronic
1158364147 18:56712144-56712166 CACTGGGAGCTGTTGGAAAGTGG + Intronic
1158616289 18:58990806-58990828 AAGCTGGAGCTGTGGGAAAAGGG + Intergenic
1160390494 18:78527699-78527721 GAGTGGGAGCTGTGGGGAGCAGG - Intergenic
1160465058 18:79069378-79069400 AAGTGGGAGGGGCGGGAAAGGGG + Exonic
1160548426 18:79677938-79677960 AAATGGGGATTGTGGGAAAATGG - Intergenic
1161325620 19:3662301-3662323 AAGTTGGAGCTGTTTCAAAATGG - Intronic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1162551464 19:11360711-11360733 AAGTAGTGGCTGTGGGAAAGGGG + Intronic
1162575836 19:11498239-11498261 AGTTGGGAGCGGTGGGAATATGG - Intronic
1162729032 19:12706535-12706557 GAGTGGGGGCTGTGGGATCAGGG + Intronic
1163870261 19:19815391-19815413 TGGTGGCAGCTGTGGGAAAAGGG + Intronic
1163879482 19:19904834-19904856 TGGTGGCAGCTGTGAGAAAAGGG - Intronic
1163904853 19:20143470-20143492 TGGTGGCACCTGTGGGAAAAGGG + Intergenic
1163948344 19:20561426-20561448 TGGTGGCAGCTGTGGGAAAAGGG + Intronic
1163969762 19:20780856-20780878 TGGTGGCAGCTGTGGGAAAAGGG - Intronic
1164000289 19:21092206-21092228 TGGTGGCAGCTGTGGGAAAAGGG - Intronic
1164022659 19:21322239-21322261 TGGTGGCAGCTGTGGGAAAAGGG + Intronic
1164048492 19:21563480-21563502 TGGTGGCAGCTGTGGGAAAAGGG + Intergenic
1164183177 19:22837678-22837700 TGGTGGCAGCTGTGGAAAAATGG - Intergenic
1164272038 19:23681363-23681385 TGGTGGTAGCTGTGGGAAAGTGG + Intronic
1164306443 19:24007884-24007906 TGGTGGCAGCTGTGGGAAAAGGG + Intergenic
1164844595 19:31421097-31421119 TAGGGGGCACTGTGGGAAAAGGG - Intergenic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1165720052 19:38072737-38072759 AAGTCGGGACTGTTGGAAAAAGG + Intronic
1165767742 19:38361558-38361580 AAGTGGGTGGGGTGGGAAAGAGG + Intronic
1166211284 19:41308212-41308234 GAGTGGGAGCTCTGTGAGAACGG - Intronic
1167117229 19:47495405-47495427 AAGTGGGAGCTGGGGGGATTAGG - Intronic
1167379182 19:49128782-49128804 AAGGGGCAGATGTGAGAAAAAGG - Intronic
1167568095 19:50269649-50269671 AAGCAGGGGCTGTGGGAAACAGG + Intronic
1167579275 19:50332366-50332388 AGGTGGGGGCTGTGGGGAAAAGG + Intronic
1167634042 19:50643302-50643324 AAGTCGAGGCTGTGGGGAAATGG + Intronic
1167837381 19:52085318-52085340 AAGTGGAATCTATGGTAAAAGGG + Intronic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
925717342 2:6796486-6796508 AACAGGGAGCTGCAGGAAAAAGG - Intergenic
925894982 2:8464103-8464125 AAGTGGGGGCTGTGGGGCTAAGG - Intergenic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926001508 2:9336995-9337017 AATTAGGAGGTTTGGGAAAACGG + Intronic
926429506 2:12771835-12771857 TAGTGGGAGTTTGGGGAAAACGG + Intergenic
927498384 2:23565506-23565528 AAGAGGGAGCTGGGGGGAAGAGG + Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927509676 2:23636603-23636625 AAGTGGCTGCTGTGGGACAGTGG - Intronic
928925409 2:36573856-36573878 TGGCGGGAGGTGTGGGAAAATGG + Intronic
929051356 2:37839564-37839586 AGGTGGGAGTAATGGGAAAAGGG + Intergenic
929188349 2:39118587-39118609 AAGTGGGGGCTGTGGTAAGGTGG + Intronic
929618064 2:43327893-43327915 CAGTGGGATCTCTGGGAGAAGGG - Intronic
929759309 2:44793286-44793308 TAATGGGTGCTGAGGGAAAACGG + Intergenic
930058707 2:47271686-47271708 ACGTGTGAGGTGTGGGAAGATGG + Intergenic
930758478 2:55004579-55004601 AAGTGGGAGCAATTAGAAAAAGG - Intronic
932222583 2:70011114-70011136 GGGTGGGGGGTGTGGGAAAAGGG + Intergenic
932578891 2:72980699-72980721 AAGAGGCAGCTGTGATAAAAAGG - Intronic
932715962 2:74100938-74100960 CAGTTGGAGCTCTGGGCAAAGGG - Exonic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
935087366 2:99861017-99861039 AAGGGGGAGCTGTTGGTTAAGGG - Intronic
935567143 2:104620972-104620994 ACGTGGAAGCTGTGAGAAACTGG - Intergenic
935946150 2:108288611-108288633 AGGTGGGGGCTGGGGGGAAATGG - Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936743895 2:115549936-115549958 ATGTGTGTGATGTGGGAAAAAGG - Intronic
936830545 2:116640507-116640529 AAGTGGCATCTTTGGGAAGATGG - Intergenic
936946963 2:117939829-117939851 AAGTGGGAATTGTAGGATAATGG + Intronic
937161384 2:119765603-119765625 TAGTGGGAGCAGTGGTATAAAGG + Intronic
937164287 2:119796341-119796363 GTGGGGGAGCTGTGGGAGAAGGG - Intronic
937234708 2:120423667-120423689 TAGTGGGAGCTGAGAGGAAAGGG - Intergenic
938341040 2:130536796-130536818 AAGTAGGAGCCGTGGGGAGAGGG - Intergenic
938348790 2:130583913-130583935 AAGTAGGAGCCGTGGGGAGAGGG + Intronic
938628922 2:133143746-133143768 CAGTGGCAGCTATGTGAAAAGGG - Intronic
939023549 2:136985704-136985726 CTGGTGGAGCTGTGGGAAAAAGG + Intronic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
939287999 2:140157309-140157331 CAGAGAGAGCTGTGGGGAAAAGG - Intergenic
939540020 2:143482472-143482494 ACTTGGGTGCTGTGGGAAAATGG + Intronic
939655484 2:144819007-144819029 AACTGGGAGCTGAAAGAAAAAGG - Intergenic
939755695 2:146106673-146106695 AAGTGCTAGCAGTTGGAAAATGG + Intergenic
940254414 2:151713925-151713947 AACTGGGAGCTGTAAGAAAAGGG + Intronic
941257148 2:163246318-163246340 AAGGGTGAGCTGTGGAAAATAGG + Intergenic
941687475 2:168461914-168461936 AGGTGGCAGCAGAGGGAAAATGG + Intronic
941762987 2:169265110-169265132 AAGGGGAAGATGTGGGAAGATGG - Intronic
942421811 2:175815412-175815434 AAGTGGGGGCTGTCAGAGAAGGG - Intergenic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
942822191 2:180127189-180127211 AATTGGGAGCTTTGGGAAAAGGG + Intergenic
944410515 2:199437510-199437532 AACTGAGACATGTGGGAAAATGG + Intronic
945505710 2:210637856-210637878 CAGTGGGGGATGGGGGAAAAGGG - Intronic
945600947 2:211864189-211864211 AAGAAGGAGAGGTGGGAAAAAGG - Intronic
945989364 2:216380780-216380802 AAGTGGGCCCTGTGTTAAAATGG - Intergenic
946086059 2:217172911-217172933 AAGTGGGAGCTGTGGCTCATGGG + Intergenic
946625149 2:221603706-221603728 AAGAGTGAGTGGTGGGAAAATGG + Intergenic
946865181 2:224036200-224036222 GAGTCGAAGCTGTGGGAACATGG + Intronic
947443540 2:230144230-230144252 GAGTGGGAGACCTGGGAAAATGG - Intergenic
1168810115 20:699669-699691 AAGCAGGAGAGGTGGGAAAAAGG - Intergenic
1168928139 20:1599499-1599521 AACTGGGAGCAGGGGGAAAGGGG - Intronic
1169552300 20:6713611-6713633 ATGTTGCAGGTGTGGGAAAAGGG + Intergenic
1169730484 20:8780483-8780505 ATGTGGGAGATATGGGAAAGGGG - Intronic
1169934831 20:10872095-10872117 AAGTGGGAGCTCTAGGAAGGAGG - Intergenic
1169953096 20:11069931-11069953 AAGAGGGAGCTCTGAGAAGACGG - Intergenic
1170494855 20:16914895-16914917 TAGTGGGAGCTGGGGAAAAGTGG + Intergenic
1170993555 20:21328872-21328894 AAGAGGGAGCCTTGGGAATAGGG + Intronic
1171221400 20:23401162-23401184 AAGTGGGAGCTGGGTGCACAAGG + Intronic
1171367016 20:24632119-24632141 AAGTGGGGGCTGTGGGCCCAGGG + Intronic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172629378 20:36367754-36367776 AAGTGGGAGCTGGAGGAGCATGG - Intronic
1173086750 20:39926965-39926987 AAGTGGCAGATGTGGGAGAAGGG + Intergenic
1173539726 20:43842458-43842480 ATGTGGGGGCTGTAAGAAAAGGG - Intergenic
1173572414 20:44085974-44085996 AGGTGAGAAGTGTGGGAAAATGG + Intergenic
1174312768 20:49671777-49671799 AAGTAGATGCTGTGTGAAAAGGG - Intronic
1174390388 20:50215250-50215272 AGGAGGAAGCTGTGGCAAAATGG - Intergenic
1175948898 20:62571934-62571956 AGGTGGGGCCTGTGGGAAAGTGG + Intergenic
1175948905 20:62571951-62571973 AAGTGGGGCCTGTGGGAAGGCGG + Intergenic
1177161928 21:17557337-17557359 AAGTGGGAGCTGTGAGGAGGTGG - Intronic
1177167894 21:17623690-17623712 TAGTGGGAGTTGTGGGACAAGGG - Intergenic
1178008809 21:28258162-28258184 AATTGGGAGCTAAGGGTAAAAGG + Intergenic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1178809507 21:35868443-35868465 AGGTGGTAGCAGTGGGAGAATGG - Intronic
1178921060 21:36738587-36738609 AAGTGGCAGCTGTGGGAGGAGGG - Intronic
1179131448 21:38640862-38640884 AAGGGGGCTCTCTGGGAAAATGG + Intronic
1179172267 21:38981688-38981710 GAGTGGGTGCTGGGGGAAATTGG - Intergenic
1180135837 21:45861233-45861255 AGGTGGGTGCTGTGGGTAAGTGG - Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1182974293 22:34608222-34608244 AAGTGTGCACTGTGGGAAAGAGG - Intergenic
1183340159 22:37275661-37275683 GGGTAGGAGCTGTGGGAAAAGGG - Intergenic
1183967257 22:41449271-41449293 TGGTGGGAGCTCTGGGTAAAAGG + Intergenic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1184729581 22:46365268-46365290 GGGTGGGAGCTGAGGAAAAATGG - Exonic
1184756194 22:46517221-46517243 AAGGTGGAGCAGTGGGAAAATGG - Intronic
1184876318 22:47278034-47278056 AAGTGGGAACTGAGAGAAATGGG + Intergenic
949197162 3:1325541-1325563 ACTTGGGAGCTGTGGGAAAAGGG - Intronic
949360326 3:3224952-3224974 AAGTGGGTGCTGGGCAAAAAGGG + Intergenic
949889828 3:8725482-8725504 AAGTGGGGACTGTGGAAAATCGG - Intronic
951008404 3:17646887-17646909 AAGTGGGAGGGGTTGGAACAGGG - Intronic
951034793 3:17921227-17921249 AAGAGGGAGCCATGGGAAGATGG + Intronic
952209703 3:31217327-31217349 AAGTGAGAGCTATGGGTAACTGG - Intergenic
952278514 3:31901397-31901419 AAGTGGGGGCATTGGGAAGATGG - Intronic
953701691 3:45201056-45201078 AAGAGGAAGCTGTGGAAAAGGGG - Intergenic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
954977645 3:54711710-54711732 AAGTTGGGACTCTGGGAAAAAGG + Intronic
955145499 3:56314237-56314259 AGGTGGGGGCTGTGGGATATTGG + Intronic
955796462 3:62642475-62642497 AAGTGGGAGGGGTGGAGAAAAGG + Intronic
955931936 3:64066206-64066228 AAGGCAGAGCTGTGGGAAGAAGG + Intergenic
956612520 3:71138582-71138604 AATTAGGGGCTGTGGGAAATAGG + Intronic
957012899 3:75028328-75028350 AAGGTGGAGCTGTGAGAAGAAGG - Intergenic
957078769 3:75620290-75620312 GAGGGGGAGCGGTGGGGAAACGG - Intergenic
957326869 3:78706843-78706865 AAGAGTGAGATATGGGAAAATGG + Intronic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
959481617 3:106879525-106879547 AACTGGGAGGTGGGGGAAATGGG + Intergenic
959736172 3:109661391-109661413 ATGTGGAAGCTGTGGGACAGGGG - Intergenic
961371401 3:126434040-126434062 CAGTGGGAGCTCTGAGAACATGG - Intronic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
962716708 3:138132896-138132918 AAGGGGGACCTTGGGGAAAAAGG - Intergenic
962729852 3:138271438-138271460 AAGTGATAGATGTGGGAAACAGG - Intronic
962853774 3:139326856-139326878 AGGTGGCAGCTGTGTGGAAAGGG - Intronic
964887677 3:161503193-161503215 AAGGGGGAGATGGGGGAGAAGGG + Exonic
964887685 3:161503211-161503233 AAGGGGGAGATGGGGGATAAGGG + Exonic
965512377 3:169582411-169582433 AAGAGGGAGATGGGGAAAAACGG + Intronic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
965683508 3:171276445-171276467 AAGTGGAAGCTGTGATTAAAGGG + Intronic
965863067 3:173170322-173170344 GAGTGGGAGGTGTGAGGAAAGGG + Intergenic
966763748 3:183439892-183439914 GAGGGTGAACTGTGGGAAAAGGG + Intergenic
967417921 3:189239505-189239527 AAGAAAGAGCTGTGGGAACATGG + Intronic
968897796 4:3414862-3414884 AAGTGGGGGCTGTGTGAGAGTGG + Intronic
969482094 4:7452099-7452121 GAGTGGGAGCTGTGGGTCAGTGG - Intronic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
973933242 4:55814990-55815012 AAGAGGAAACTGTGGCAAAATGG - Intergenic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
974272511 4:59669327-59669349 AAGTGGGAGCAGAGTGGAAAAGG + Intergenic
974966250 4:68763786-68763808 AAGTGGGAGCTTTTGGACAGGGG + Intergenic
976135252 4:81929135-81929157 AAGTGGGATATCTGGGAAAAGGG - Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
976957641 4:90921679-90921701 AAATGTGAGCTGTGGCATAATGG + Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
979444072 4:120790212-120790234 AAATGGTAGCTGTTGTAAAAAGG - Intronic
979787913 4:124739842-124739864 CGGTGGGATCTGTGGGAAAATGG + Intergenic
980508554 4:133756079-133756101 TGTTGGGAGGTGTGGGAAAAGGG - Intergenic
981806789 4:148725168-148725190 AGGTGGGACCTGTGGGAAGTAGG - Intergenic
982112298 4:152067824-152067846 AGGTCTGAGCTGTGGGGAAATGG + Intergenic
983236363 4:165184843-165184865 AAGTGGGCCATGTTGGAAAATGG + Intronic
983531759 4:168816878-168816900 AAGGGGGAGCCGTGGGCAAGGGG + Intronic
983583298 4:169330217-169330239 AAGTGGGAGCAGTGGGGTGAAGG - Intergenic
984261357 4:177446253-177446275 AGGTAGGAGATGTGGGAGAATGG + Intergenic
984364898 4:178785948-178785970 TAGTGGGAGCTGCGTGAAACAGG + Intergenic
984554659 4:181199326-181199348 AAATGGGAGAGGTGAGAAAATGG + Intergenic
984676249 4:182551301-182551323 AGCTGAGAGCTCTGGGAAAAAGG - Intronic
984961657 4:185103281-185103303 AAGTGTGAGTTGAGGGAGAATGG + Intergenic
985329659 4:188817130-188817152 AAGGGGTATCTGTGGGGAAAGGG + Intergenic
985418270 4:189758834-189758856 TCGTGGGACCTGTGGGGAAAAGG - Intergenic
985998170 5:3609078-3609100 AAATAAGAGCTGTGAGAAAAGGG - Intergenic
987512389 5:18856657-18856679 TAGTTGGAGCTGTGAGAAGAAGG + Intergenic
988153756 5:27422139-27422161 CAGAGGGAGCTGGAGGAAAATGG - Intergenic
988499848 5:31775605-31775627 GAATGGGAGCTTTGGGAAATTGG + Intronic
988780224 5:34514009-34514031 AAGTGGGAAATGTTGGAAACAGG - Intergenic
989132388 5:38120212-38120234 GAGGGGGAGCTTTGGGATAAGGG - Intergenic
989372400 5:40722996-40723018 AAGGGGGAAATGTGGGGAAAAGG + Intronic
990644174 5:57825043-57825065 AACTGGCAGCTGCGGGAAAGAGG - Intergenic
991515876 5:67434730-67434752 AAATGAGAGCTGTGGGGGAAAGG - Intergenic
991539982 5:67716806-67716828 AACTGGGATTTGTGGGAACAAGG + Intergenic
991988128 5:72310401-72310423 AAGAGGGGGGTGGGGGAAAATGG + Intronic
992167948 5:74073492-74073514 GAGTTGGAGCTGAGGGAGAAGGG + Intergenic
992221821 5:74580845-74580867 AACTAGGTGCTATGGGAAAAGGG + Intergenic
994905715 5:105839220-105839242 AAGTAGGAGCTGTGAGAAGAGGG - Intergenic
995069453 5:107901862-107901884 AAGTGGGGGCTGTGGTAAACTGG + Intronic
995430234 5:112066716-112066738 AAGTTGGAGCTGTAGTAACACGG - Intergenic
995701406 5:114939402-114939424 ATGGTGGAGCTGTGAGAAAAGGG + Intergenic
995738017 5:115324229-115324251 TAATGGGAGCTGTGGGGAGATGG + Intergenic
997475731 5:134141348-134141370 AAGTGGGAGGTGTGTGTACATGG + Intronic
997496036 5:134327042-134327064 AACTGGGAGCTGGAGGAAGAGGG - Intronic
997753753 5:136375030-136375052 AAGTGGAAGCTGAGGGTTAATGG + Intronic
998605787 5:143633204-143633226 AAGTGGAAGATGTGGGGAATAGG + Intergenic
998950208 5:147386152-147386174 ATGTGGGAACTGTAGGGAAAAGG - Exonic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
999668093 5:153934363-153934385 TACTGGGAGCTGTGAGAACAGGG - Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000480441 5:161767250-161767272 AAGTGGCAGGTGAGGGACAAAGG - Intergenic
1001266333 5:170277141-170277163 TGGTGTGAGTTGTGGGAAAAGGG - Intronic
1001425698 5:171620872-171620894 AAGTGACAACTGTGGAAAAATGG + Intergenic
1001785359 5:174408012-174408034 ATTTGGGAGATATGGGAAAAGGG - Intergenic
1002134201 5:177097991-177098013 CAGGGGGAGGTGTGGGGAAAGGG - Exonic
1002972985 6:2043463-2043485 AGGTGGGAGCTGTGGAGACAGGG - Intronic
1003111471 6:3255006-3255028 ATGTGGGAGCGCTGGGATAATGG + Intronic
1003630989 6:7787000-7787022 AAATGGCAGCTCTGGGGAAAAGG - Intronic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005753906 6:28908720-28908742 AAGTGGGAAACGTGGGATAAGGG - Intronic
1005774062 6:29110059-29110081 AAGTGGGAGGGGCAGGAAAATGG - Intergenic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006887239 6:37392435-37392457 AAGTAGTCGCTGTGGGGAAAGGG - Exonic
1007693718 6:43718662-43718684 ACTTGAGAGCTGTGGGAAATGGG + Intergenic
1007922360 6:45621874-45621896 GAGTGAGAGCAGTGGAAAAATGG + Intronic
1008482844 6:52004979-52005001 AGGAGGGAGCTGTGCAAAAAAGG - Intronic
1008908957 6:56712355-56712377 AAGTAGGAGGAGTAGGAAAAAGG - Intronic
1009923021 6:70086415-70086437 AAGAGGAAGGTGAGGGAAAAAGG + Intronic
1010021128 6:71161181-71161203 AAGTGGGACCTGAGGGACCATGG - Intergenic
1011277257 6:85643159-85643181 GAGTGGGAGCAGTGGGGTAAAGG - Exonic
1011330927 6:86205833-86205855 AAATTGTAGCTGTAGGAAAATGG + Intergenic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1013080595 6:106808631-106808653 AAGAGAGAGCAGGGGGAAAAGGG - Intergenic
1013176063 6:107677937-107677959 AAGTGGGAGAAGGGGGAAAGGGG + Intergenic
1014947397 6:127515195-127515217 AAGAGGAAACTGGGGGAAAAAGG + Intronic
1015484451 6:133752467-133752489 TAGTGGGAGGTTTGGCAAAATGG + Intergenic
1017024108 6:150166572-150166594 AGGCGGTAGCTGTTGGAAAATGG + Intronic
1017048730 6:150371125-150371147 AGGGAGGAGCTGTGGGAAAGGGG + Intronic
1017068677 6:150552545-150552567 AAGTGGGAGAAGTGGGGAAGAGG - Intergenic
1017541769 6:155409916-155409938 AACTGGGAGCTGTGGGACTGAGG - Intronic
1019059017 6:169242604-169242626 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059061 6:169242729-169242751 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059159 6:169243025-169243047 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059193 6:169243125-169243147 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1020878274 7:13726201-13726223 AAGGGGAAGCTTTGGGAACAAGG + Intergenic
1021463936 7:20920535-20920557 AAGTGGGAAATGTTGGCAAATGG - Intergenic
1021570730 7:22062431-22062453 CAGAGGGAGCTGTGTGGAAAAGG + Intergenic
1022262271 7:28717934-28717956 AATGTGGAGCTGAGGGAAAAAGG - Intronic
1022689916 7:32638794-32638816 AAATGGGGGCTATGGAAAAATGG - Intergenic
1022917508 7:34973031-34973053 AAATGGGGGCTATGGAAAAATGG - Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1024305916 7:47929518-47929540 CCGTGGGAGCTGTGGGAGAGAGG + Exonic
1024953595 7:54892123-54892145 AAGGGGGAGCTGGGTGGAAATGG - Intergenic
1025775627 7:64558379-64558401 GGGTGGCAGCTGTGGGAAAAGGG + Intronic
1025778951 7:64582550-64582572 TGGTGGTAGCTGTGGGGAAAAGG - Intergenic
1025815562 7:64907890-64907912 TGGTGGCAGCTGTGGAAAAAAGG - Intronic
1027507400 7:79034477-79034499 AAATAGGAGCAGTGGCAAAAGGG - Intronic
1028460257 7:91084527-91084549 CAGTGGGAGCTGTGTGGAAGAGG - Intronic
1029557406 7:101279868-101279890 AGGTGGGGGCTCTGGGAAAGAGG + Intergenic
1029838892 7:103341917-103341939 AAGTTGAACCTGTGGGAAGATGG - Exonic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1030278163 7:107742444-107742466 AATAGGGAGGTATGGGAAAAAGG + Intergenic
1030595648 7:111535763-111535785 CAGTGGTGACTGTGGGAAAAGGG + Intronic
1030930856 7:115521969-115521991 AAAGGGCTGCTGTGGGAAAAGGG - Intergenic
1032179464 7:129663190-129663212 AAGGGGGAAATGTGGGGAAAAGG - Intronic
1032279227 7:130487380-130487402 AAGTACCAGCTGTGGGATAATGG + Intronic
1033390475 7:140923813-140923835 AAGTGGGAGCTGGGGTTAGAAGG + Intronic
1034031449 7:147770378-147770400 AAGAGGGAGGAGTGGGGAAATGG + Intronic
1034908175 7:154969610-154969632 AAGTGGCAGCTGTGGCGAGAAGG - Intronic
1034959806 7:155358244-155358266 AAGGAGGAGCTGTGGGCAGAGGG - Exonic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035825196 8:2637444-2637466 ATGTGGGAGCTTTGGAAAAGTGG - Intergenic
1035917417 8:3640110-3640132 AAGTGGGACAGGTGGAAAAAAGG - Intronic
1036547065 8:9782163-9782185 AAGTGGAGGGTGAGGGAAAAAGG - Exonic
1036557358 8:9872054-9872076 GATTGGGAGCTTTGGGAAAGTGG + Intergenic
1037088882 8:14887915-14887937 AACTGGGATCTGAGGGAAATAGG + Intronic
1037173678 8:15923066-15923088 AATTGGCAGCCCTGGGAAAAGGG + Intergenic
1037723316 8:21463332-21463354 AGGTGGGTGCAGTGTGAAAATGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039628178 8:39077961-39077983 AAGTAGGAGCTGGGGTAGAAGGG + Intronic
1042037060 8:64545193-64545215 GAGTGAGAGCACTGGGAAAAGGG - Intergenic
1042152493 8:65803266-65803288 AAATGGGAGCAATGGGAACAAGG - Intronic
1042685839 8:71439362-71439384 AAGTTGGAGGTGGGGGTAAAGGG + Intronic
1043564272 8:81530809-81530831 AAGAGAGAGCAGTGTGAAAATGG + Intronic
1043957271 8:86375398-86375420 AAGGGAGAGAAGTGGGAAAATGG - Intronic
1044294023 8:90506378-90506400 AACTGGGAGCTGTGGGATGAGGG + Intergenic
1044628994 8:94261192-94261214 AAGTGGTATCTGTGGGTAAGAGG - Intronic
1045711420 8:104989008-104989030 AGGTGGGTGCTGTGGCAAATTGG + Intronic
1049271251 8:141697438-141697460 AACTGGGAGCTGATTGAAAAGGG - Intergenic
1049342459 8:142120522-142120544 AAGAGGGAGGTGTGGGCACAGGG - Intergenic
1049977303 9:871901-871923 AAATGGTAGTTGTTGGAAAAGGG - Intronic
1050304100 9:4289404-4289426 AAGTGCGAGCTGATAGAAAAAGG + Intronic
1050386650 9:5097929-5097951 AAGGAAGTGCTGTGGGAAAAAGG - Intronic
1050754232 9:8980245-8980267 AATTAGGAGCTGTGGGACAAAGG + Intronic
1050924442 9:11246003-11246025 AGGTGGGATCTGAGTGAAAAGGG + Intergenic
1051006112 9:12346684-12346706 AAATTGAAGCTTTGGGAAAAAGG + Intergenic
1051807320 9:21009784-21009806 AATTGGGAGCTGTTGGTCAAAGG - Intronic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1052014253 9:23446676-23446698 AGGTGGGGGCGGTGGGAAATTGG + Intergenic
1052025420 9:23568586-23568608 AAGTTGAAGCTGGGGGAAAAGGG - Intergenic
1052440595 9:28491922-28491944 AAAGGGAAACTGTGGGAAAAAGG + Intronic
1052913432 9:33904988-33905010 ATGTGGGAGCTTTGGGGATAGGG + Intronic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1055298060 9:74853417-74853439 AAGGGGGAAATGTGGGGAAAAGG + Intronic
1055387734 9:75781301-75781323 AAAAAGGAGATGTGGGAAAATGG - Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1057042044 9:91855158-91855180 ACGTGGGTCCTGTGGGATAAGGG - Intronic
1057842041 9:98494294-98494316 AAGTGGGAGTTGGAGGAACAGGG + Intronic
1058005325 9:99907368-99907390 AAGTGGGAGCTCTGGGCCGATGG + Intronic
1058439159 9:104991534-104991556 AGGGGCCAGCTGTGGGAAAAGGG + Intergenic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1058763192 9:108156535-108156557 AAGTGGGAGTTGGCAGAAAAGGG - Intergenic
1059062222 9:111045342-111045364 AAGGGGATGGTGTGGGAAAAAGG - Intergenic
1060417684 9:123444190-123444212 AAATGGGAGCAGTGGGCCAAAGG - Intronic
1060745463 9:126127998-126128020 AAGAGGGAGTGGTGGGGAAAGGG + Intergenic
1062255868 9:135620210-135620232 AAGGGGGAGTAGGGGGAAAAGGG - Intergenic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1187380216 X:18794794-18794816 TACTGGGAGCTGGGGGAAGAAGG + Intronic
1188039721 X:25357789-25357811 ATGTGGGAGCTCTGTGAAAAAGG - Intergenic
1188135421 X:26488663-26488685 AAAAGGGAGCTTTGGGAAATGGG - Intergenic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1188867722 X:35334103-35334125 AATTGGGAGATGTGGGTCAAAGG + Intergenic
1189368541 X:40409243-40409265 AATTGGGGGATGTGGGAAATGGG + Intergenic
1189388676 X:40557876-40557898 ATGTAGGAGCTGAGGGACAAAGG + Intergenic
1189592003 X:42523475-42523497 AATTGGGAGCTGGGAGAAAAAGG - Intergenic
1189637752 X:43030008-43030030 AAGTGGGAAATGGGGGAAATGGG - Intergenic
1190035327 X:47018216-47018238 AAGAAGGAGGTGTGGGAAGAAGG - Intronic
1190370016 X:49731326-49731348 AACTGGGATCTGTGGGTGAAGGG + Intergenic
1191604296 X:63044441-63044463 AAGTGGGAGATGGGGAAGAATGG - Intergenic
1191699496 X:64024539-64024561 AACTGGGGGCTGAGGGAAGATGG - Intergenic
1194268695 X:91783073-91783095 AGGTGAGAGATGTGGGCAAAGGG + Intronic
1194365669 X:93010964-93010986 CAGTAGCAGCAGTGGGAAAATGG + Intergenic
1194984885 X:100479576-100479598 AAGTGGGAGTAGTGGAACAAAGG + Intergenic
1195884895 X:109627417-109627439 AGGAGGGAGAGGTGGGAAAATGG - Intronic
1196604891 X:117646011-117646033 TAGAGGGAGCTCGGGGAAAAAGG - Intergenic
1196939225 X:120759429-120759451 AAATGTGAGGTGGGGGAAAAGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1199103679 X:143837393-143837415 CAGTGGGAGCTGTGGACAAGCGG + Intergenic
1199663749 X:150080567-150080589 GAGTGGCAGCTGAGGGAGAATGG - Intergenic
1199781305 X:151062797-151062819 AAATGGGAGCTGTTGGTCAATGG - Intergenic
1200421957 Y:2979562-2979584 AAGTGTGAGATGTGCGAGAAAGG + Exonic
1200585897 Y:5003989-5004011 AGGTGAGAGATGTGGGCAAAGGG + Intronic
1200987377 Y:9317310-9317332 GAGAGAGAGATGTGGGAAAATGG + Intergenic
1201059160 Y:10028705-10028727 GAGAGAGAGATGTGGGAAAATGG + Intergenic