ID: 1074663226

View in Genome Browser
Species Human (GRCh38)
Location 10:115688276-115688298
Sequence AGGGGATACCTGGACTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074663226_1074663235 25 Left 1074663226 10:115688276-115688298 CCATGTGAGTCCAGGTATCCCCT 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1074663235 10:115688324-115688346 ATACCCAGTAGTGGAATGGTTGG No data
1074663226_1074663234 21 Left 1074663226 10:115688276-115688298 CCATGTGAGTCCAGGTATCCCCT 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1074663234 10:115688320-115688342 ATAGATACCCAGTAGTGGAATGG No data
1074663226_1074663233 16 Left 1074663226 10:115688276-115688298 CCATGTGAGTCCAGGTATCCCCT 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1074663233 10:115688315-115688337 TTTGGATAGATACCCAGTAGTGG 0: 42
1: 849
2: 4040
3: 26650
4: 16991
1074663226_1074663231 -2 Left 1074663226 10:115688276-115688298 CCATGTGAGTCCAGGTATCCCCT 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1074663231 10:115688297-115688319 CTTGATACACTGATTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074663226 Original CRISPR AGGGGATACCTGGACTCACA TGG (reversed) Intronic
905001098 1:34670879-34670901 AGGGGTTTAATGGACTCACAGGG + Intergenic
905037161 1:34925710-34925732 AGGGGCTACCTGAGCTCAAAGGG + Intronic
909190500 1:72543082-72543104 AGGGCATCCTTGAACTCACATGG + Intergenic
911390003 1:97229911-97229933 AGGGGATACAAGGATTCACATGG - Intronic
919835934 1:201573434-201573456 AGGGTTTACCTGGGGTCACATGG - Intergenic
924496032 1:244589973-244589995 AGGGGAGACCTGGAATAGCATGG + Intronic
1063891934 10:10639468-10639490 AGGAGATATCTGTCCTCACAAGG + Intergenic
1064348846 10:14558033-14558055 AGGAATTACCTGGACTCACGGGG - Intronic
1066810726 10:39330776-39330798 AAGGGATATTTGGATTCACATGG - Intergenic
1074226844 10:111493327-111493349 ATGGCACCCCTGGACTCACATGG - Intergenic
1074663226 10:115688276-115688298 AGGGGATACCTGGACTCACATGG - Intronic
1075064879 10:119282618-119282640 GGGAGAAACCTGGACCCACAGGG - Intronic
1076721326 10:132394652-132394674 AGGGGATACCTGGGCTGATGAGG + Intergenic
1080538161 11:33242635-33242657 AAGAGATACCTGTACTCCCATGG + Intergenic
1081809987 11:45909252-45909274 AGGGGCTGCCTGGGCTCCCATGG - Intergenic
1081869579 11:46377209-46377231 ACGGGACACCAGGACTCACCGGG - Exonic
1084583016 11:70036214-70036236 AAGGGACACCTGGAGTCACCAGG - Intergenic
1085273828 11:75285689-75285711 CGGGGATACCAGGGCTCACAAGG + Intronic
1085389911 11:76177027-76177049 ACGGGAAACCAGGACTCAGAGGG - Intergenic
1086937842 11:92764087-92764109 AGGTGAACCCTGGACTCAAATGG - Intronic
1095069323 12:37820929-37820951 AAGGGATATTTGGATTCACATGG + Intergenic
1095077881 12:37954742-37954764 AGGGGATATTTGGATTCACATGG - Intergenic
1095363950 12:41378908-41378930 TGGGGATACTGGGACTCTCAGGG + Intronic
1096590518 12:52655906-52655928 AGGAGATTCCAGGACACACACGG + Intergenic
1102650411 12:114438281-114438303 AGGGGAGACCTGGGCTCCTAGGG + Intergenic
1103230886 12:119329375-119329397 AGGGGAGATCTGGACACAGAAGG + Intergenic
1104380467 12:128303133-128303155 AGGAGAAACCTGAACCCACATGG - Intronic
1104758913 12:131285575-131285597 AGGGGATTCCGGGGCTCCCAGGG - Intergenic
1104818056 12:131659964-131659986 AGGGGATTCCTGGAGTCCCTGGG + Intergenic
1104821697 12:131680921-131680943 AGGGGATTCCGGGGCTCCCAGGG + Intergenic
1108047518 13:46397175-46397197 AGTGGTTTCCTGGACTCACCTGG + Intronic
1108357697 13:49642326-49642348 AGTGTATTCCTGAACTCACAGGG - Intergenic
1113461067 13:110482549-110482571 AAGGCATGCCTGGACTCAAAGGG + Exonic
1115059028 14:29168403-29168425 AGGGAATACCTGTGCTCTCAGGG + Intergenic
1121801495 14:96777924-96777946 AGGGGATTTCTGGAATTACAAGG - Intergenic
1123847028 15:24313084-24313106 AGGGGAGACCAGGTGTCACAAGG + Intergenic
1124645696 15:31436366-31436388 AGAGGATACCAGGACACAGAGGG - Intergenic
1125810603 15:42537572-42537594 AAGGGATACCTGCACTCCCATGG + Intronic
1130983107 15:88826467-88826489 AGGGGACCCCTGGAGACACAGGG + Intronic
1133887698 16:9845931-9845953 AGGGGATACATGGATGAACAGGG - Intronic
1133897589 16:9944201-9944223 AGGGCTTACCAGGGCTCACAAGG - Intronic
1135005415 16:18817915-18817937 AGGGGAGACCTTGTCTCAAAGGG - Intronic
1136704467 16:32174625-32174647 AGGGCACCCCTGGGCTCACATGG - Intergenic
1136763445 16:32754781-32754803 AGGGCACCCCTGGGCTCACATGG + Intergenic
1136804655 16:33115605-33115627 AGGGCACCCCTGGGCTCACATGG - Intergenic
1139958981 16:70706883-70706905 AGGAGACACCTGGAGTCTCACGG + Intronic
1141344053 16:83229068-83229090 AGGCCATACCGGGCCTCACAGGG + Intronic
1141380640 16:83573540-83573562 AGGTTATATCTGGACTCAAAGGG - Intronic
1141430943 16:83969859-83969881 AGGGAATCCCCCGACTCACAGGG - Intronic
1142215550 16:88827986-88828008 AGAGGAGCCCTGGCCTCACAGGG + Intronic
1203065595 16_KI270728v1_random:1015102-1015124 AGGGCACCCCTGGGCTCACATGG + Intergenic
1148534733 17:48430005-48430027 AGGGGACACCAGGCCTCCCACGG - Intronic
1148863765 17:50618171-50618193 AGGGGGCTCCTGGACTAACATGG + Intronic
1151604923 17:75130132-75130154 AGGGGACCACTGGACTCAGAGGG + Exonic
1152627066 17:81392721-81392743 AGAGGAGACCAGGACTCCCAGGG + Intergenic
1156609539 18:38710147-38710169 AGGGGATCCCTGGAACTACAAGG - Intergenic
1156613169 18:38751542-38751564 AGGGGAAACCTAGACTGAGAGGG - Intergenic
1159942516 18:74419169-74419191 GGGGGATACCTAGAGTCGCATGG - Intergenic
1160343314 18:78108915-78108937 AGGGGCAACCTGCACCCACATGG + Intergenic
1160351828 18:78189208-78189230 AGGTGATACCTGCACACACCTGG - Intergenic
1160760202 19:780192-780214 AGGGGATGCATGGATTCTCAGGG - Intergenic
1163005264 19:14393470-14393492 AGGGGCTTCCAGGATTCACAGGG + Intronic
1164601003 19:29563116-29563138 AGGGGATGCCGGGATGCACAAGG + Intronic
1166129863 19:40739723-40739745 AGGTGCTACCTGGTCTCCCAAGG - Exonic
1166900310 19:46056503-46056525 AGGGGATCCCTGGATACATAGGG - Intronic
1167132998 19:47600011-47600033 AAGGGATACTTGAACTGACACGG - Intergenic
1168160166 19:54505153-54505175 AGGTGATGCCTGCACTCCCAGGG - Intronic
1168200087 19:54808702-54808724 ATGGGATGCCAGGACTCCCAGGG + Intronic
1168204873 19:54842737-54842759 AAAGGATCCCTGGACTCCCAGGG + Intronic
925875615 2:8308956-8308978 AGGGGACAGTGGGACTCACAGGG + Intergenic
926762499 2:16291390-16291412 TGGGGATACCTTGACTTACTTGG + Intergenic
928505601 2:31949294-31949316 AAGGGATACCTGCACTCCTATGG + Intronic
931112647 2:59128504-59128526 AGGTAAGACCTGAACTCACATGG + Intergenic
933273244 2:80256215-80256237 AGGGGAAAACTGAATTCACATGG - Intronic
940760304 2:157731581-157731603 TGAGAATACCTGGACACACAGGG + Intergenic
942591251 2:177549081-177549103 AGGGGCTACCAAGACTGACAGGG + Exonic
946405289 2:219489070-219489092 CGGGGATGCCTGAGCTCACAGGG - Exonic
946709182 2:222488660-222488682 AGGGGAGCCCTGAACTCACATGG - Intronic
947164338 2:227246692-227246714 AGGGGTTTCCAGGACTCCCAGGG + Exonic
947599523 2:231437385-231437407 AGGGGACCTCTGGAGTCACAGGG + Intergenic
1172792509 20:37515607-37515629 AGGAAATACCTGGGCTCACATGG + Intronic
1173363080 20:42361702-42361724 AGCCGAGAACTGGACTCACACGG - Intronic
1175704299 20:61164677-61164699 AGGGGATACCTGGAAACACCTGG + Intergenic
1176117287 20:63438606-63438628 GGGGGACACCTGGACTCACCTGG + Exonic
1178450842 21:32698123-32698145 AGGGGATGCAGGGACTAACAGGG - Intronic
1181761177 22:25059794-25059816 AGGGGACCCCTGCACTCTCAGGG + Intronic
1183618629 22:38959981-38960003 AGGGCCTACCTGACCTCACAAGG + Intronic
1183639533 22:39084625-39084647 AGGGCCTACCTGACCTCACAAGG + Intronic
952861778 3:37818785-37818807 AGGTGTGACCTGCACTCACAGGG - Intronic
953451852 3:43012641-43012663 AGGGGATATGTGAAGTCACAGGG + Intronic
954013428 3:47663628-47663650 AGGGGACCTCTGGAATCACAGGG - Intronic
962025843 3:131546750-131546772 CTGGGGTACCAGGACTCACATGG - Intronic
964119721 3:153170231-153170253 TGGGGACACCTGTATTCACAAGG - Intergenic
969704859 4:8786158-8786180 AGGGGATGCCTGGGCTCCCAGGG - Intergenic
970455967 4:16224749-16224771 ACTGGATACCTGGACTTCCATGG - Intronic
971215912 4:24662029-24662051 TGGGGATACAAAGACTCACAAGG - Intergenic
971379089 4:26080577-26080599 AGTGGATACCTGGAGTGACTGGG - Intergenic
973560889 4:52134166-52134188 AGTGGATACCTGGACAAACCCGG + Intergenic
991937515 5:71816558-71816580 AGAGGAAACCTGGACACACAAGG - Intergenic
992255570 5:74917694-74917716 AGAGGACATCTGGACACACAAGG - Intergenic
995673792 5:114639106-114639128 AGAGGATACCTGGACACACAGGG + Intergenic
999454415 5:151703018-151703040 AGGGGATATGTGGACACACTTGG - Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1004349310 6:14877260-14877282 AGGGGATAAATGGAATCACAGGG + Intergenic
1006266672 6:32931488-32931510 AGGGGTTATCAGGACTCAGAAGG - Intergenic
1009254033 6:61352795-61352817 AAGGGATATTTGGAGTCACATGG + Intergenic
1009258719 6:61454616-61454638 AAGGGATATTTGGAGTCACATGG + Intergenic
1013275691 6:108582823-108582845 AGGGGGTACCGAGAGTCACATGG - Intronic
1017944692 6:159085864-159085886 AGGGCAAACCTAGCCTCACAAGG - Intergenic
1018931722 6:168244303-168244325 GGGGGATTCCTGGAAGCACAAGG + Intergenic
1019710587 7:2516548-2516570 AGAGGAGGCCTGGACTCAGATGG + Intronic
1019757439 7:2783307-2783329 AGGGGTTGCCTGGACTGCCATGG + Intronic
1021565738 7:22014622-22014644 AGGGGATTCTTGGACACTCATGG + Intergenic
1023913178 7:44569474-44569496 TGGGGGTACCTTGACTCCCAAGG - Intronic
1024506840 7:50168863-50168885 CAGGGATACTGGGACTCACATGG + Intergenic
1025574776 7:62622638-62622660 AAGGGATATTTGGATTCACATGG - Intergenic
1030176354 7:106659929-106659951 AGGGGACAGCTGGACCCGCAGGG - Exonic
1030335284 7:108318765-108318787 AGGGGAGACCGGGATTCCCAGGG - Intronic
1032089466 7:128904037-128904059 AGGGGACAGGTGGACTCACCAGG + Exonic
1037627737 8:20622707-20622729 AGGGGATACATGGAAGCATACGG + Intergenic
1038534510 8:28344249-28344271 AGGGAGTTCCTGGACCCACAAGG + Intergenic
1043515938 8:80994647-80994669 TGGGGATGCTGGGACTCACAGGG + Intronic
1048367794 8:133753551-133753573 AAGGGATGCCTGGAGTCACCAGG - Intergenic
1048843488 8:138584930-138584952 TTGGGATACCTGGGCCCACATGG - Intergenic
1050876168 9:10639644-10639666 AGGGCTTACCTGGACTCGCAGGG - Intergenic
1051185998 9:14461916-14461938 AGGGGAGAACTGGATTCAGATGG + Intergenic
1052194554 9:25695639-25695661 CGGGGATAACAGGACTCACTGGG + Intergenic
1053255120 9:36610494-36610516 AGGAGAAGCCTGGACACACATGG - Intronic
1055265707 9:74493770-74493792 AAGGGATGCCTGCATTCACATGG - Intergenic
1056471051 9:86904723-86904745 AGGGAATTCCTCAACTCACATGG - Intergenic
1056900091 9:90590842-90590864 ATGGGATAGCTGTATTCACATGG + Intergenic
1185813802 X:3135009-3135031 AGTGGATACTTGGTTTCACATGG + Intergenic
1187489324 X:19736330-19736352 ATGGGAAACCTGGAAACACAGGG + Intronic
1191575262 X:62696897-62696919 AAGGGATATTTGGATTCACATGG - Intergenic
1191911190 X:66151925-66151947 AAGGGATATCTGCACTCTCATGG - Intergenic
1196333235 X:114497286-114497308 AAGGGATATCTGCACTCCCATGG + Intergenic
1200078766 X:153565324-153565346 AGGGGATGCCTGGGCTCTGAAGG - Intronic
1201267821 Y:12225560-12225582 AGTGGATACTTGGTTTCACATGG - Intergenic
1201291344 Y:12423395-12423417 TGGGAATACCTGGAAACACAAGG - Intergenic