ID: 1074664075

View in Genome Browser
Species Human (GRCh38)
Location 10:115697895-115697917
Sequence TCGAGCCAAGCCAATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074664071_1074664075 26 Left 1074664071 10:115697846-115697868 CCTGTACTTGGCTGTCCTTTCTG No data
Right 1074664075 10:115697895-115697917 TCGAGCCAAGCCAATGATGGAGG No data
1074664072_1074664075 11 Left 1074664072 10:115697861-115697883 CCTTTCTGTTGTAAATTAAAATA No data
Right 1074664075 10:115697895-115697917 TCGAGCCAAGCCAATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074664075 Original CRISPR TCGAGCCAAGCCAATGATGG AGG Intronic