ID: 1074670509

View in Genome Browser
Species Human (GRCh38)
Location 10:115785125-115785147
Sequence ACATATCCACCGATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074670509_1074670513 26 Left 1074670509 10:115785125-115785147 CCCCTCTCCATCGGTGGATATGT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1074670513 10:115785174-115785196 TCAAAATACAATGATGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074670509 Original CRISPR ACATATCCACCGATGGAGAG GGG (reversed) Intronic
900464531 1:2818612-2818634 ACATATGCACACATGCAGAGAGG - Intergenic
902545656 1:17188463-17188485 ACATGTCCATCAATAGAGAGAGG - Intergenic
902640907 1:17765541-17765563 ACATAGCCTGCCATGGAGAGGGG - Intronic
904913269 1:33951150-33951172 ACATCTCCAGGGCTGGAGAGAGG + Intronic
908038721 1:60084356-60084378 ACAGATCCACTGACAGAGAGAGG - Intergenic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
912389783 1:109295044-109295066 ACTCTTCCACCGGTGGAGAGAGG + Intronic
916378635 1:164183938-164183960 ACATATCCACTGTTGGAGAATGG - Intergenic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
919174678 1:194003411-194003433 ACATATCCAACACTGGAAAGAGG + Intergenic
919425219 1:197421507-197421529 ACAACACCAGCGATGGAGAGTGG + Exonic
919598865 1:199598748-199598770 ACTTATCCACTGATGGACACAGG - Intergenic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921463830 1:215461658-215461680 ACATATCCCCTGATGGAGGAGGG - Intergenic
922503199 1:226111361-226111383 ACATAGCCACCTCTGGAGTGTGG + Intergenic
1065217144 10:23460034-23460056 ACATATCCAGCGATTGAGGGTGG + Intergenic
1066285916 10:33965997-33966019 AGGTATCGACCAATGGAGAGAGG - Intergenic
1070698248 10:78579044-78579066 ACTTGTCCACAGATGCAGAGAGG - Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1079123782 11:17704085-17704107 ACATACCAACCAATGGGGAGAGG + Intergenic
1084679555 11:70658756-70658778 ACATCTCCACCCGTGGTGAGAGG - Intronic
1084784739 11:71435636-71435658 ACACATCCGCCGATGGGCAGAGG - Exonic
1084837113 11:71810780-71810802 ACCTATCCAAGCATGGAGAGGGG - Intergenic
1087290937 11:96319700-96319722 ACATCTCCCCCAAAGGAGAGAGG + Intronic
1090996379 11:131869400-131869422 ACATCTACCCCGAAGGAGAGTGG - Intronic
1092262475 12:6959980-6960002 ACATCTCCACCAAGGGTGAGGGG + Exonic
1092401589 12:8183294-8183316 ACCTATCCAAGCATGGAGAGGGG + Intronic
1100277097 12:93081315-93081337 ACATAAGCAGCGAAGGAGAGGGG + Intergenic
1100634583 12:96423411-96423433 ACATGTGCACTTATGGAGAGAGG - Intergenic
1101268254 12:103114818-103114840 ACATATCCACCCAGGGACAGTGG + Intergenic
1102401386 12:112632669-112632691 ACATGTCCCCTGAAGGAGAGGGG - Intronic
1106180360 13:27364414-27364436 CCATGTCCACCGATAGAAAGTGG - Intergenic
1107440349 13:40421351-40421373 ACATATCCACCAATGGGAATTGG + Intergenic
1109414437 13:62019860-62019882 ACATATACACAGAGAGAGAGTGG + Intergenic
1110569715 13:76991058-76991080 ACATATCCTCCAATGGATTGTGG + Exonic
1113554087 13:111217262-111217284 AAAAATCCACTAATGGAGAGTGG + Intronic
1115531481 14:34332051-34332073 ATATACACACCGATGGGGAGGGG + Intronic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1117998494 14:61500722-61500744 AAATATCCACCTTTGCAGAGTGG - Intronic
1128809098 15:70557040-70557062 TCACATCCACCGAGGGAGAAGGG - Intergenic
1131798342 15:96043766-96043788 GCATCTCCACCGAGGGAGGGAGG + Intergenic
1133992302 16:10717852-10717874 AAATATCCAGGGAGGGAGAGGGG - Intergenic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1139717792 16:68827610-68827632 ACATAACCAGCTATGGGGAGTGG - Intronic
1141526748 16:84616894-84616916 AGATAGCCACTGATGGGGAGGGG - Intronic
1151007611 17:70455929-70455951 AAATATCCATCGATGAAGACTGG - Intergenic
1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG + Intronic
1162177567 19:8842543-8842565 ACCTATCCCCAGAGGGAGAGAGG + Intronic
1166557913 19:43713673-43713695 ACACATGCACCGATGCAGACTGG - Intergenic
1168105637 19:54164367-54164389 ACATTTCCAACGGTGGAGGGAGG - Intronic
926175934 2:10592223-10592245 ACAGATCCAGCTATGGAGATGGG + Intronic
932817035 2:74870333-74870355 ACATAGCCACAGATGGCCAGTGG + Intronic
934620642 2:95802121-95802143 ACAGCTCCACCCATGGAGAATGG - Intergenic
934812795 2:97297602-97297624 ACAGCTCCACCCATGGAGAATGG + Intergenic
934824900 2:97410870-97410892 ACAGCTCCACCCATGGAGAATGG - Intergenic
935115688 2:100134065-100134087 ACATTTCCAAAGATAGAGAGTGG - Intronic
938152312 2:128897956-128897978 ACATATCCACAGCTGGACTGAGG + Intergenic
943721934 2:191213751-191213773 GCATACCTACCCATGGAGAGTGG + Intergenic
945447159 2:209951810-209951832 ACATATACATAAATGGAGAGGGG - Intronic
946704588 2:222445680-222445702 ACACATCCTCCCATCGAGAGCGG - Intronic
947964839 2:234270758-234270780 ACATATGAACCGATAGACAGTGG + Intergenic
1168747471 20:256064-256086 ATATATCCATAGATAGAGAGAGG + Intergenic
1169543192 20:6622995-6623017 ACATACCCACCCATGGAGCCAGG + Intergenic
1172981062 20:38942069-38942091 ACATATCCAGAAATTGAGAGAGG - Exonic
1174081201 20:47971893-47971915 ACAGAGGCACTGATGGAGAGAGG - Intergenic
1174765749 20:53252513-53252535 AAATATCCATCAATGGAGATGGG - Intronic
1177422850 21:20883949-20883971 ACATAACCACCGATGGATGCTGG - Intergenic
1182751707 22:32646821-32646843 ACAGAACCACAGAGGGAGAGGGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950882132 3:16330596-16330618 ACGTATCCACCACAGGAGAGTGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
960701810 3:120447020-120447042 AGACATCCACCAAGGGAGAGTGG + Intronic
961933112 3:130554687-130554709 ACACATCCACCTGTGGAGAAGGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
969825971 4:9758752-9758774 TCATATCCAGGGGTGGAGAGGGG - Intergenic
972156996 4:36175717-36175739 ACTTATCAAAAGATGGAGAGGGG + Intronic
980882774 4:138730036-138730058 ACATATAAACCAATGGAGACTGG + Intergenic
981857254 4:149309269-149309291 ACATATCCCCCGCTGGATAAAGG - Intergenic
985142341 4:186854442-186854464 ACATACTCACCGATGAAGTGAGG - Intergenic
985845941 5:2346979-2347001 ACAACTCCACCCATGGAGAGTGG - Intergenic
989806590 5:45614927-45614949 GCATATTCACAGGTGGAGAGTGG + Intronic
997802065 5:136873596-136873618 GCACATCCAAGGATGGAGAGAGG - Intergenic
1007212185 6:40203341-40203363 ACATATCCATTGTTGAAGAGAGG + Intergenic
1008674792 6:53807857-53807879 ACATTTGCATCGATGGAGTGGGG + Intronic
1017132419 6:151118983-151119005 ACACATCCAGGGGTGGAGAGTGG + Intergenic
1017245588 6:152221084-152221106 ACATATCCACATTTGGTGAGAGG - Intronic
1018540003 6:164869405-164869427 AGCTTTCCACCGCTGGAGAGAGG - Intergenic
1019183300 6:170206482-170206504 ACATATCCACCCATGGTCAAAGG - Intergenic
1022307461 7:29160723-29160745 ACATATGCACTGAGGCAGAGAGG + Intronic
1023632384 7:42177251-42177273 AAATATCCCCTGATGCAGAGTGG + Intronic
1026678130 7:72445576-72445598 ACAGATCCACCGATGGGCATGGG + Intronic
1028485632 7:91354530-91354552 ACATATACACTGATGTATAGGGG - Intergenic
1029905856 7:104092970-104092992 ACATATACACAGATGGGGACAGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1030973945 7:116097251-116097273 ACATATCCTCCCATGGATAAAGG - Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1034881248 7:154764228-154764250 GCAAATCCACCGAGCGAGAGTGG - Intronic
1036275970 8:7352272-7352294 ACCTATCCAAGCATGGAGAGGGG - Intergenic
1036345386 8:7958095-7958117 ACCTATCCAAGCATGGAGAGGGG + Intergenic
1036840712 8:12118841-12118863 ACCTATCCAAGCATGGAGAGGGG + Intergenic
1036862518 8:12365099-12365121 ACCTATCCAAGCATGGAGAGGGG + Intergenic
1037047162 8:14321373-14321395 AGATATTTAGCGATGGAGAGAGG + Intronic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1037163119 8:15796144-15796166 ACATATCCACCGACATAGACTGG - Intergenic
1038344065 8:26715908-26715930 AAATATCCATCCATAGAGAGTGG - Intergenic
1043184613 8:77130941-77130963 ACAAAACCATCGAGGGAGAGTGG + Intergenic
1044343682 8:91077594-91077616 ACATATGCAAGGATGGAGTGGGG - Intronic
1046732978 8:117745714-117745736 ATATATCCAACCATGTAGAGAGG - Intergenic
1047057079 8:121177215-121177237 GCATATCCCCCCATGGATAGGGG - Intergenic
1056865140 9:90222149-90222171 TCATATCCAGCGGGGGAGAGGGG - Intergenic
1056917882 9:90760736-90760758 TCATATCCAGCGGGGGAGAGGGG + Intergenic
1057516770 9:95728894-95728916 ACAAACCCACTGGTGGAGAGCGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058518055 9:105795167-105795189 TAATATCCAGCGGTGGAGAGGGG - Intergenic
1058538862 9:105991408-105991430 CTATTTCCACCCATGGAGAGGGG - Intergenic
1059999358 9:119944236-119944258 ATATATCCACCAATGCAAAGTGG - Intergenic
1185787322 X:2901868-2901890 TCACATTCACAGATGGAGAGGGG - Intergenic
1186603189 X:11060671-11060693 GCAAATCCACACATGGAGAGAGG - Intergenic
1195148434 X:102042363-102042385 ACAACTCAACCCATGGAGAGTGG + Intergenic
1197226860 X:123962420-123962442 ACATATGCACCAAGGGGGAGCGG - Intronic
1202071429 Y:20995729-20995751 CCATATCAACCAATGGAGAAAGG + Intergenic