ID: 1074672947

View in Genome Browser
Species Human (GRCh38)
Location 10:115815880-115815902
Sequence CATTATAGCCTCAAATTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074672946_1074672947 1 Left 1074672946 10:115815856-115815878 CCTTATAATTCTTTTTAAAAATC 0: 1
1: 4
2: 18
3: 182
4: 1530
Right 1074672947 10:115815880-115815902 CATTATAGCCTCAAATTGCCAGG No data
1074672945_1074672947 5 Left 1074672945 10:115815852-115815874 CCTGCCTTATAATTCTTTTTAAA 0: 1
1: 3
2: 18
3: 225
4: 1664
Right 1074672947 10:115815880-115815902 CATTATAGCCTCAAATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074672947 Original CRISPR CATTATAGCCTCAAATTGCC AGG Intronic
No off target data available for this crispr