ID: 1074673102

View in Genome Browser
Species Human (GRCh38)
Location 10:115818053-115818075
Sequence ATGGAGCAGCTAAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074673102_1074673108 18 Left 1074673102 10:115818053-115818075 CCCTCCTCTTTTAGCTGCTCCAT 0: 1
1: 0
2: 0
3: 30
4: 277
Right 1074673108 10:115818094-115818116 TTTCATTTTATTGCTTTCCAGGG No data
1074673102_1074673107 17 Left 1074673102 10:115818053-115818075 CCCTCCTCTTTTAGCTGCTCCAT 0: 1
1: 0
2: 0
3: 30
4: 277
Right 1074673107 10:115818093-115818115 CTTTCATTTTATTGCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074673102 Original CRISPR ATGGAGCAGCTAAAAGAGGA GGG (reversed) Intronic
900354206 1:2252232-2252254 ACGGAGCAGCTAAAAATGAATGG - Intronic
900689554 1:3972097-3972119 ATCGAGCAGATCAAAGAGGGAGG - Intergenic
902521296 1:17018496-17018518 ATGGAGCAGCAAAGAGGTGAAGG + Intergenic
903420421 1:23215005-23215027 ATGAAGCCGCAAAAAGATGAGGG + Intergenic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906926863 1:50127194-50127216 ATGGATCAGCTATCAGAGGCAGG - Intronic
910066682 1:83161830-83161852 ATGTTGCAGCTACAAGATGAGGG + Intergenic
911809812 1:102261460-102261482 ATGGAGCAGCTAAAACCTGTAGG - Intergenic
912546357 1:110454238-110454260 CTGGATCAGCTATCAGAGGAGGG - Intronic
913071877 1:115306746-115306768 CTTGAGAAGCTAAAAGAAGATGG - Intronic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
916199890 1:162260699-162260721 AAGGAGCAGCAAAAAAAGGTGGG - Intronic
917265873 1:173220279-173220301 AAGGAGCAGTTAAAAGATAAAGG + Intergenic
917751163 1:178054863-178054885 ATTGAGCAGCAAAAAATGGATGG - Intergenic
918014048 1:180615660-180615682 ATGGTCGAGCCAAAAGAGGAGGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920268983 1:204749042-204749064 AGGGAGCAGCTACCAGATGAGGG - Intergenic
922968678 1:229715839-229715861 TAGGAGCAGCTAAAGGTGGAGGG + Intergenic
923371548 1:233319047-233319069 GTGGAGCAGCTGAAAGATGGTGG - Intergenic
924247751 1:242101402-242101424 ATGGGGCAGCTGAAAGAAGGGGG + Intronic
924399916 1:243668007-243668029 ATAGAGCAGGTAAGAGAAGATGG - Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
1064269326 10:13850741-13850763 ATGGTGCAGTGAAAAGAGAATGG + Intronic
1065304335 10:24354453-24354475 ATGGCAGAGCTAAAAGAGCATGG - Intronic
1065395533 10:25232805-25232827 ATGAATAAGCTAAAAGAAGAGGG - Intronic
1066205954 10:33189405-33189427 ATGGACCATGTAAAAGATGACGG - Intronic
1067405178 10:46016134-46016156 ATTAACCAGCTAAAAGATGATGG + Intronic
1067831664 10:49614251-49614273 AGGGAGGAGGTACAAGAGGAAGG + Exonic
1068398080 10:56489965-56489987 AAAGAGCAGGTAAAAGAGGTAGG + Intergenic
1069207637 10:65711922-65711944 ATGGTGTACCTCAAAGAGGATGG + Intergenic
1070062645 10:72999816-72999838 AATGTTCAGCTAAAAGAGGAAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070467925 10:76743422-76743444 ATAGAACAGCTAAAAGAAGAAGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071338956 10:84624948-84624970 ATGTAGCAGCCAAAAGGAGAAGG + Intergenic
1071368195 10:84923045-84923067 AAGGAGAAGCTAGAAAAGGATGG + Intergenic
1071513219 10:86280356-86280378 AAGGAGCAGCAAGTAGAGGAGGG - Intronic
1074115087 10:110450860-110450882 ATGGACCAGCTAAGGGAGGCAGG + Intergenic
1074253304 10:111775639-111775661 AGGGAGCAGATAAAAGAGTAGGG + Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074684327 10:115945691-115945713 ATCTAGCAGCTAGGAGAGGAAGG - Exonic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075530336 10:123223673-123223695 AGGGTGCAGCTGAGAGAGGAAGG - Intergenic
1075607748 10:123826484-123826506 ATGAATCAGCTAAAATTGGAAGG + Intronic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1079151555 11:17904293-17904315 TTGCAGCAGCTAAAAGTGAATGG + Intronic
1079788739 11:24709477-24709499 AAGGAGAAGCTAAAAGAGAAAGG + Intronic
1081751048 11:45511616-45511638 AGGGAGCAGATGAGAGAGGAGGG - Intergenic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1084327625 11:68410965-68410987 CTGGATCTGCTAAAAGAAGAGGG + Intronic
1086994083 11:93336686-93336708 CTGGAGAAGCTAAAACAGAAAGG - Intronic
1087278104 11:96180584-96180606 ATGGAGCAGCTTACAGACCAAGG - Intronic
1087457342 11:98403552-98403574 AAGCAGGAGGTAAAAGAGGAAGG + Intergenic
1088187766 11:107192580-107192602 AAGAAGCAGAGAAAAGAGGATGG - Intergenic
1088226154 11:107622439-107622461 AAAGAGCACCTCAAAGAGGAAGG + Intronic
1088964156 11:114701102-114701124 ATGGCTCAGCTAAAAGAAGCTGG + Intronic
1089473521 11:118739875-118739897 ATGGAGCAGGGAAAAGAGCAAGG + Intergenic
1090766015 11:129876980-129877002 ATGGAACAATTAAAACAGGAAGG + Intronic
1090932397 11:131310009-131310031 ATGGAGCAGCTTACAGGGCAAGG - Intergenic
1091111213 11:132970169-132970191 ATGAAGCATGTGAAAGAGGAGGG - Intronic
1092837729 12:12507268-12507290 ATGGAACTGCTAAAAGGAGAGGG - Intronic
1094469025 12:30785561-30785583 AAAGAGCAGGTAGAAGAGGAAGG + Intergenic
1095289233 12:40457721-40457743 ATGGAGTACCTAAAAGGGCATGG + Intronic
1096760176 12:53835195-53835217 ATGGATAAACTAAGAGAGGAGGG - Intergenic
1097157824 12:57025734-57025756 ATGCAGCATCTCAAAGAGGATGG + Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101229049 12:102721059-102721081 GGAGAGCAGCTAAAAGAGGATGG - Intergenic
1101545447 12:105707833-105707855 ATGGAGCAGATAAACATGGAAGG + Intergenic
1102943896 12:116968246-116968268 ATGGAGCAGACAAAAGTGGGTGG - Intronic
1103794550 12:123494414-123494436 ATGGGGCAGGGAAGAGAGGAGGG - Intronic
1104061552 12:125272683-125272705 ATGGGGGAGCTAAAGGCGGAGGG + Intronic
1105550067 13:21385554-21385576 ATGAAGCAGAGAAAAGAAGATGG + Intronic
1106839106 13:33667587-33667609 ATGGTGCATCTCACAGAGGATGG - Intergenic
1108459090 13:50647263-50647285 AAGCATCAGCTCAAAGAGGAAGG + Intronic
1109741079 13:66556361-66556383 ATGGAACAGCTACATGAGGATGG - Intronic
1110655844 13:77997844-77997866 TGGGAGCAGCTACAAGATGATGG + Intergenic
1110776143 13:79410392-79410414 TTGGTGCAGCTAAAAGATGAAGG - Intergenic
1110932828 13:81244297-81244319 ATGCAGCATATAAAAAAGGAAGG - Intergenic
1111285167 13:86081601-86081623 ATGGATCAAATAAAAAAGGAGGG + Intergenic
1111352673 13:87051994-87052016 ATGGAGTAACTAAAAGAGTATGG - Intergenic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112927030 13:104688660-104688682 CTGGTGCTGCTCAAAGAGGAGGG - Intergenic
1116510850 14:45744778-45744800 GTGGTGCAGGTAAAAGATGATGG - Intergenic
1117350957 14:54881240-54881262 ATGGAGGGGCTATAGGAGGAGGG + Intronic
1118838650 14:69494828-69494850 AAGGGGCAGCTAAAATAGCAGGG + Intronic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1120889501 14:89479068-89479090 ATCATGCAGCTGAAAGAGGAAGG + Intronic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121303438 14:92889995-92890017 AGGGAGCAGTCAAAAGAGGTGGG + Intergenic
1121950655 14:98168066-98168088 TTGGAGCGGCTAAAACAGCAAGG + Intergenic
1122811663 14:104292298-104292320 GTGGGGCAGCTGAGAGAGGAAGG + Intergenic
1125144546 15:36451542-36451564 ATGAAAAAGATAAAAGAGGAAGG - Intergenic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1128612815 15:69087600-69087622 ACGGAGCACCTAACAGAGGCTGG + Intergenic
1129137020 15:73563144-73563166 ATGGAGTAGCTAAGATTGGAGGG - Intronic
1129147984 15:73666606-73666628 GAGGAGTAGCTAAAAGAGAATGG - Intergenic
1130560067 15:84951142-84951164 ATGGAGCAGCTTCAAGTTGAAGG + Intergenic
1130886247 15:88094945-88094967 ATTGAACAGCTAACTGAGGATGG + Intronic
1131803628 15:96098951-96098973 GTGGAGGAGGTAAAAGAAGATGG - Intergenic
1132797963 16:1734538-1734560 ATGAGCCAGCTAAAGGAGGAAGG + Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1135694936 16:24577398-24577420 ATGAAGCAGGCAAAGGAGGAAGG - Intergenic
1136176879 16:28523233-28523255 ATGGAGCAGTGAAAATAGGAAGG - Intergenic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1139636935 16:68263852-68263874 ATGGAGGAGCAAACAGAGGGAGG + Intergenic
1140035041 16:71365263-71365285 CTGGTGCAGCTCAAGGAGGAAGG + Intronic
1141222156 16:82081106-82081128 ATTGAGCAGCTAAGAGTAGATGG - Intronic
1142552199 17:747692-747714 TTTGAGCAGCTCGAAGAGGATGG + Exonic
1143317472 17:6043413-6043435 TTGGAGCATCTAAAAGCTGAAGG + Intronic
1143364382 17:6396336-6396358 AAGGAGCAGCTGAGAGAGTACGG + Intronic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1144154801 17:12488954-12488976 ATGGATCACCTACAGGAGGAAGG + Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1147744893 17:42688938-42688960 ATGGAGCTGCTCAAGGTGGATGG + Exonic
1148711751 17:49686849-49686871 ATGGTCCAGGCAAAAGAGGATGG - Intergenic
1149669353 17:58392087-58392109 ATGGGGCAGTTATCAGAGGAGGG + Intronic
1150182242 17:63135452-63135474 ATTGAGAACCTAAAAGTGGAAGG - Intronic
1150576252 17:66433474-66433496 ATGGAGTAGCTAAAGGAGCAGGG + Intronic
1150586054 17:66519140-66519162 ATGGAGCACCTAACAACGGACGG - Intronic
1151516409 17:74599014-74599036 AGGGAGCAGGTGACAGAGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156472287 18:37384792-37384814 AAGGAGCAGATAAAGCAGGAGGG - Intronic
1159215248 18:65383959-65383981 ATGGGGGAGCTAGAAGGGGATGG - Intergenic
1161294693 19:3513723-3513745 GTGGAGCAGGTAAGGGAGGAGGG - Intronic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163420716 19:17212206-17212228 CTGGAGCCCCTAGAAGAGGATGG + Exonic
1163723160 19:18907732-18907754 ATTGAGCAGCTAAAAAGAGAAGG + Intronic
1164425889 19:28141627-28141649 ACGGAGCAGCTATAAATGGAGGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164901499 19:31930002-31930024 GTGTAGCAGGTAAAAGAGAAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168473471 19:56659701-56659723 ACGGAGCAGCTTCAAGAGCATGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925310795 2:2880168-2880190 ATGGAGCAGCTAAGATTGGTAGG - Intergenic
925592923 2:5527856-5527878 ATGGTGCAGTTAAAAGAAGATGG + Intergenic
928855408 2:35797027-35797049 AAGGGGAAACTAAAAGAGGAGGG + Intergenic
928861083 2:35857643-35857665 AAGCAGCAGCTAAATGAGGCGGG - Intergenic
931039580 2:58282550-58282572 ATCTAGAAGCCAAAAGAGGAAGG - Intergenic
931114425 2:59148975-59148997 TTAGAGCAGGTACAAGAGGAAGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932919177 2:75890316-75890338 ATGTAGAAAGTAAAAGAGGATGG + Intergenic
934850707 2:97699119-97699141 AAGGAGCAGCTAAACCAGGTGGG + Intergenic
937325351 2:120986815-120986837 ATGGTGCAGTTGAAAGAGCATGG - Intronic
937355596 2:121196315-121196337 TTGGAGCAGCCAAGAGAGGCAGG + Intergenic
938843782 2:135187541-135187563 ATGGAGCTGGGAAAAGGGGATGG - Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939805327 2:146768740-146768762 ATAGAGAAGGTAAAAGAAGATGG - Intergenic
941204862 2:162559104-162559126 ATGGTGCAGTTGAAAGAGTATGG + Intronic
941563371 2:167077425-167077447 ATGGAGCAGTTAAAAAAAAAAGG + Intronic
941759669 2:169227967-169227989 GTGGAGCAGCTGAGAGAAGAAGG - Intronic
944357476 2:198808611-198808633 GAGGAGGAGCTAAAAGAGGTGGG - Intergenic
946071177 2:217035543-217035565 ATGGGGCAGTTAAAAGTTGAGGG + Intergenic
946467109 2:219921680-219921702 GTGGAGCAGGTGAGAGAGGACGG + Intergenic
946783325 2:223215835-223215857 ATGCAGCAGCCAAAAGACCAGGG - Intergenic
947829945 2:233132452-233132474 ATGGAGCAGCTAGAAGCTGAAGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
1168847944 20:958277-958299 GGGGAGCTGATAAAAGAGGAGGG - Intergenic
1169144849 20:3245663-3245685 ATTGACCAGCTAAAAGAGTTTGG - Intergenic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1172633685 20:36394996-36395018 ACGGGGAGGCTAAAAGAGGAGGG - Intronic
1173789507 20:45818656-45818678 ATGGGGTTGCTAAAAGAGAAGGG + Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1177718247 21:24868417-24868439 ATTGAGCATATAAAACAGGAAGG - Intergenic
1181453018 22:23036637-23036659 AAGTAGCTGCTGAAAGAGGAAGG + Intergenic
1182126125 22:27817036-27817058 TTTGAGCAGCTGAAACAGGACGG + Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182950510 22:34370970-34370992 AAGGAACAGAGAAAAGAGGAGGG - Intergenic
1183495351 22:38140164-38140186 AAGGAGCTGATGAAAGAGGAAGG + Exonic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
951469913 3:23045029-23045051 TTGGGGTAGCTAAAAGAGAAGGG + Intergenic
951486300 3:23215176-23215198 ATAAACCAGCTAAAAGTGGATGG - Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953183358 3:40616511-40616533 GGGGAGCAGATAAAGGAGGACGG + Intergenic
954585158 3:51728267-51728289 AGGGAGCAGAAAAGAGAGGAGGG + Intergenic
954764199 3:52898951-52898973 ATGGAGCAGGGAAAAGGGAATGG - Intergenic
954781411 3:53064644-53064666 GTGGAAGAGGTAAAAGAGGAGGG - Intronic
958129190 3:89395820-89395842 ATGGAGCTGTAAAGAGAGGATGG - Exonic
959548275 3:107623445-107623467 ATGTGGCAGCTAAAAGTAGAAGG - Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960926238 3:122797150-122797172 ATGTAGCTGCTAAAAAAGAAAGG + Intronic
962346587 3:134623517-134623539 ATGGAGCAGCCAGGAAAGGAAGG - Intronic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
963871591 3:150421224-150421246 ATGGAGTGACTCAAAGAGGAAGG - Intronic
964148653 3:153497379-153497401 ATGCAGCAGTTAGAAGAGGAAGG + Intronic
964320555 3:155492134-155492156 ATGGATCAGCTCTGAGAGGAAGG + Intronic
964621362 3:158722941-158722963 GTGGAGCAAATAAAAGAGCAGGG + Intronic
965177908 3:165359935-165359957 AGGAAGCTGCTAAAAGAGGCTGG - Intergenic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966274155 3:178144198-178144220 ATGGAGCAATTAAAAAAGAAGGG + Intergenic
966720942 3:183062226-183062248 CTGGAGCACCTAAAAGATGAGGG - Intronic
966763803 3:183440754-183440776 AGGGAGCAAGAAAAAGAGGAAGG + Intergenic
967654869 3:192034990-192035012 ATGGAGCACCTTCAAGAGAACGG + Intergenic
967766724 3:193288907-193288929 ATGTTGTAGCCAAAAGAGGATGG - Intronic
969128634 4:4974070-4974092 ATGGAGGGGCCAAAAGAAGATGG + Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
971414877 4:26415614-26415636 ATGCAGCAGCTAAACTTGGAAGG + Exonic
972325168 4:38008285-38008307 CTGTAGGAGCTAAAAGAGGGTGG - Intronic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972987754 4:44785458-44785480 ATGCAGCAGTTTAAAGAGGAGGG - Intergenic
974218620 4:58934743-58934765 ATATTGCAGCTGAAAGAGGATGG - Intergenic
976747385 4:88417488-88417510 ATGAAGCAGCTGAGAGATGATGG - Exonic
976793916 4:88911294-88911316 ACGGAGCAGCTCAAAGTGGCTGG + Intronic
977177199 4:93831998-93832020 ATGAAGCACCAAAAAGAGCAAGG + Intergenic
978077318 4:104548888-104548910 ATGGAACAGCTAAATGGGTAAGG - Intergenic
979975611 4:127192591-127192613 AAGTAGCACCAAAAAGAGGAAGG - Intergenic
982805574 4:159758672-159758694 AGGTGGGAGCTAAAAGAGGAGGG + Intergenic
982905408 4:161063147-161063169 AAGGAGAGGGTAAAAGAGGAAGG - Intergenic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
984625040 4:181997352-181997374 ATGGACCACCTAAATGAGGTGGG + Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
989202739 5:38781328-38781350 ATAGTGCAGCTAGTAGAGGAGGG - Intergenic
989665680 5:43850932-43850954 GTGGTACAGATAAAAGAGGATGG + Intergenic
990000116 5:50882877-50882899 ATGGAGTGGCAAGAAGAGGAAGG - Intergenic
992358939 5:76016213-76016235 GTGCAGCAGAAAAAAGAGGAAGG + Intergenic
992442162 5:76806466-76806488 GTGGATGAGCCAAAAGAGGAGGG - Intergenic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993751023 5:91668080-91668102 ATGGAACAGATAACAGAGAAAGG + Intergenic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
995636912 5:114203102-114203124 GTGGAGCAGTGAATAGAGGATGG + Intergenic
995727819 5:115201115-115201137 ATGGAGAACTTAAAAGTGGAAGG - Intergenic
996608081 5:125347180-125347202 ATGTTGCAGCAAAAAGAAGAAGG + Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998717655 5:144904249-144904271 ATGGATCAGATAAAAGAACAAGG + Intergenic
998953581 5:147415664-147415686 AAGAAGAAGCTAAGAGAGGAGGG + Intronic
999105419 5:149066584-149066606 ATGGAGAAGTTAAAAGCTGAAGG + Intergenic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1002457268 5:179352546-179352568 ATGAAGGAGATAAAAGAGGCAGG + Intergenic
1002493832 5:179598789-179598811 ATGGAGCTGCAACAAGTGGAAGG + Exonic
1003732612 6:8842796-8842818 ATAGAGCAGTTAAAATGGGAGGG - Intergenic
1004179103 6:13365503-13365525 ATGAAGCAGCTGATCGAGGAGGG - Exonic
1004945523 6:20608543-20608565 ATGGTGCTGCTAAATGAGGAAGG - Intronic
1007036263 6:38677144-38677166 AAGGAACAGCTGAAATAGGAAGG + Exonic
1007068741 6:39019172-39019194 AGGGAGGAGGTAAAAGAGGCAGG + Intronic
1008380064 6:50831390-50831412 ATGGGGCAGCTAAGAGGAGAGGG - Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010570136 6:77464989-77465011 ACTGAGCAGCTGGAAGAGGATGG - Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1014288633 6:119532690-119532712 ATTGAGCAGAGAAAAAAGGATGG + Intergenic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1024916514 7:54506102-54506124 ATGGAAGAGCTAAAACAAGAAGG + Intergenic
1026575301 7:71566637-71566659 ATCTCGCAGCTAGAAGAGGAAGG - Intronic
1027277425 7:76572931-76572953 ATGTTGCAGCTACAAGATGAAGG - Intergenic
1028451788 7:90993446-90993468 TTGGAGCAGGCAAGAGAGGATGG + Intronic
1028935548 7:96459798-96459820 ATGTAGCAGCTAAGAGTAGAGGG + Intergenic
1028999202 7:97135340-97135362 TTGGAGCAGCTAAGAGAGGCAGG - Intronic
1031608634 7:123798814-123798836 ATGAAGCAGCTACAAGATGGTGG + Intergenic
1033315106 7:140290672-140290694 AGGGATCAGCTAGAAGAGGAAGG - Intergenic
1034456833 7:151175221-151175243 AAGGAGCAGATAAAAGAGGCAGG + Intergenic
1037896540 8:22660146-22660168 ACAGAGCACCTAAGAGAGGAAGG + Intronic
1038056533 8:23863642-23863664 ATGAAGCAGCTTAGGGAGGAGGG + Intergenic
1038401728 8:27289028-27289050 AGGGATCAGCTGAGAGAGGAGGG + Intronic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1039458521 8:37724604-37724626 ATAGTGCAGAGAAAAGAGGAAGG + Intergenic
1039955224 8:42202328-42202350 ATGGATGAGCTAACAGAGGCCGG - Intronic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1041574032 8:59372440-59372462 TTGTAGCAACTAAAAGAGAAAGG - Intergenic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1044965503 8:97570106-97570128 ATGGAACAGTTACAAGAGAAAGG - Intergenic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045446717 8:102273721-102273743 ATTAAGCAGCTATAAAAGGAAGG + Intronic
1046282926 8:112057501-112057523 ATGGAAAACATAAAAGAGGAGGG - Intergenic
1046705199 8:117441716-117441738 ATGGAGGATCTAAAAGAGAGGGG - Intergenic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047397116 8:124511341-124511363 ATCAAGCAGCTTACAGAGGAGGG - Intronic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1052353478 9:27481301-27481323 ATGCTCCAGCTAAAAGATGATGG + Intronic
1053613569 9:39740879-39740901 ATGCAGCAGCTAAACTTGGAAGG - Intergenic
1053871610 9:42498836-42498858 ATGCAGCAGCTAAACTTGGAAGG - Intergenic
1054239945 9:62601518-62601540 ATGCAGCAGCTAAACTTGGAAGG + Intergenic
1054554078 9:66636044-66636066 ATGCAGCAGCTAAACTTGGAAGG + Intergenic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1056459642 9:86797329-86797351 ATGGAGCTGATAAAAGAGAGTGG - Intergenic
1056869181 9:90261034-90261056 GTGGAGAAGCTAAAAGACAATGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057089577 9:92245106-92245128 GTGGGGCAGCTTGAAGAGGAGGG - Intronic
1058536251 9:105963337-105963359 ATGGTGCAGTGAAAAGAGCAAGG - Intergenic
1058944875 9:109846809-109846831 TTGGAGCTGCTAAAGAAGGAAGG - Intronic
1059657966 9:116373618-116373640 GTAGAGCATCTAAAAGATGAAGG - Intronic
1060654655 9:125361685-125361707 AATAAGAAGCTAAAAGAGGAAGG - Intronic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187713456 X:22077332-22077354 AGGGAGTAGGTAAAAGAGGTGGG - Intronic
1187770375 X:22689284-22689306 ATGGAACTGTTGAAAGAGGAAGG + Intergenic
1188053219 X:25511890-25511912 AAGCAGCAGCTAGAAGTGGAAGG - Intergenic
1188841441 X:35022717-35022739 ATGGGGCAGCTCAAAGTGGGGGG + Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192698708 X:73445988-73446010 ATGGATTAGCTAAAAGGGGGTGG + Intergenic
1193121849 X:77831422-77831444 ATGGAGCAAATTAAAGGGGAAGG - Intronic
1193892474 X:87067368-87067390 ATGTAGCAGCTAAAAGAATGAGG + Intergenic
1193980949 X:88181093-88181115 CTGGAGCAGCTAAAGGAGTGTGG - Intergenic
1194197121 X:90908008-90908030 ATGGAGCAAAGAAAAGATGATGG + Intergenic
1195200745 X:102547851-102547873 ATGAGGCAGCTAAAGGAGTAAGG + Intergenic
1196527726 X:116746940-116746962 ATGGAGCACAAAAAAGAGCAGGG - Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1200542975 Y:4482211-4482233 ATGGAGCAAAGAAAAGATGATGG + Intergenic