ID: 1074679161

View in Genome Browser
Species Human (GRCh38)
Location 10:115886131-115886153
Sequence CTCATAGTATGCAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074679156_1074679161 -1 Left 1074679156 10:115886109-115886131 CCACCGAGTGAAACCAAAGGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1074679161 10:115886131-115886153 CTCATAGTATGCAGGACAAATGG No data
1074679157_1074679161 -4 Left 1074679157 10:115886112-115886134 CCGAGTGAAACCAAAGGACCTCA 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1074679161 10:115886131-115886153 CTCATAGTATGCAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074679161 Original CRISPR CTCATAGTATGCAGGACAAA TGG Intronic
No off target data available for this crispr