ID: 1074682006

View in Genome Browser
Species Human (GRCh38)
Location 10:115916763-115916785
Sequence AGCTGCAGCCTTGGGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074681999_1074682006 27 Left 1074681999 10:115916713-115916735 CCAACTCCCCAACTACTCTGTGT 0: 1
1: 0
2: 2
3: 19
4: 237
Right 1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG No data
1074682002_1074682006 19 Left 1074682002 10:115916721-115916743 CCAACTACTCTGTGTCTGTCCAG 0: 1
1: 0
2: 1
3: 41
4: 414
Right 1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG No data
1074682001_1074682006 20 Left 1074682001 10:115916720-115916742 CCCAACTACTCTGTGTCTGTCCA 0: 1
1: 0
2: 0
3: 21
4: 185
Right 1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG No data
1074682003_1074682006 0 Left 1074682003 10:115916740-115916762 CCAGACTTCTCAGTGCTGATACA 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG No data
1074682000_1074682006 21 Left 1074682000 10:115916719-115916741 CCCCAACTACTCTGTGTCTGTCC 0: 1
1: 0
2: 3
3: 19
4: 188
Right 1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074682006 Original CRISPR AGCTGCAGCCTTGGGAGCTC AGG Intronic
No off target data available for this crispr