ID: 1074683088

View in Genome Browser
Species Human (GRCh38)
Location 10:115930403-115930425
Sequence CTAGTTCTGAAGCTTGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074683088_1074683090 -4 Left 1074683088 10:115930403-115930425 CCATACACAAGCTTCAGAACTAG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1074683090 10:115930422-115930444 CTAGTCATACATCCCATGAAGGG No data
1074683088_1074683089 -5 Left 1074683088 10:115930403-115930425 CCATACACAAGCTTCAGAACTAG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1074683089 10:115930421-115930443 ACTAGTCATACATCCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074683088 Original CRISPR CTAGTTCTGAAGCTTGTGTA TGG (reversed) Intronic
903366707 1:22809934-22809956 CTGGTTCTGAAGGTAGGGTAGGG + Intronic
907142343 1:52199524-52199546 CTAGTGCTGAATCTATTGTATGG + Intronic
907710335 1:56875031-56875053 CCAGTTCTACAACTTGTGTAAGG + Exonic
909268994 1:73599605-73599627 CTAGTTCTCAAGCTTGTGGATGG - Intergenic
911455434 1:98116612-98116634 CTATTTCTGATCCTTCTGTAGGG - Intergenic
917878963 1:179314553-179314575 CTTGTTCCGAAGATTATGTAGGG + Intronic
918638670 1:186811715-186811737 CTAGTTCTCCAGCTTGTAGATGG - Intergenic
920660401 1:207910202-207910224 CAAGTTCTAAAGCTAGTGGATGG - Intronic
924207604 1:241729456-241729478 CTAGTTCTTAAGGTTCTCTAGGG + Intronic
1063015478 10:2072531-2072553 CTACTTCTGAGGCTTTTGAAGGG + Intergenic
1064454930 10:15478474-15478496 CTAGTTCTGAAGAGTGTGAATGG - Intergenic
1065464568 10:26005516-26005538 CTGATTTTGAAGGTTGTGTAAGG + Intronic
1065520253 10:26565283-26565305 CTGGTTGTGAAGCTCGTGTCAGG - Intronic
1066652208 10:37667226-37667248 CTGGTGCTCCAGCTTGTGTATGG - Intergenic
1074683088 10:115930403-115930425 CTAGTTCTGAAGCTTGTGTATGG - Intronic
1076398195 10:130157168-130157190 CTAGTTCTCCAGCATGTGGAGGG - Intronic
1084609572 11:70193644-70193666 CTTGGTCTGAGGCTTGTCTAGGG - Intergenic
1087351304 11:97036046-97036068 CTGGTTTTGAAGATTGAGTAAGG + Intergenic
1087983768 11:104651321-104651343 CTAGTTCTGAACATTGGTTATGG - Intergenic
1088220077 11:107561207-107561229 ATAGTTGTGAAATTTGTGTATGG - Intronic
1090077738 11:123590158-123590180 CTAATGCTGAAGGTTGTATAGGG + Intronic
1091334280 11:134754778-134754800 CTAGTACTGAAACTTATGGATGG - Intergenic
1091501580 12:1022917-1022939 CTAGATCTGATGGTTTTGTAAGG + Intronic
1092520954 12:9272228-9272250 CCAGTTCTGAAGCATGATTAGGG - Intergenic
1094170836 12:27490078-27490100 CTAGTTTTTAAGCTTGTGCTTGG - Intronic
1094265161 12:28550358-28550380 CTAGTTAGGCAGCTTGTCTAAGG - Intronic
1094384212 12:29876234-29876256 CAAATTTTGAAGGTTGTGTAAGG + Intergenic
1095381504 12:41599393-41599415 GTAGGTCTGGTGCTTGTGTATGG + Intergenic
1099391313 12:82082745-82082767 CCAGTTCTGTAGTTTGTGTCAGG + Intergenic
1100518937 12:95355072-95355094 CTACTTCACAAGGTTGTGTAAGG - Intergenic
1102175284 12:110869481-110869503 CTAGTTCTGAAACTTCTCTAAGG + Intronic
1103628192 12:122236854-122236876 CTTGCTCTGAAGTCTGTGTATGG + Intronic
1107302333 13:38978554-38978576 CTAGTCCTAGTGCTTGTGTATGG - Intronic
1111181305 13:84669697-84669719 CTAGTTCTTAAGCTCTTGAATGG + Intergenic
1111620598 13:90720191-90720213 TTAATTCTGAGGCTTGTGAAAGG + Intergenic
1114333113 14:21657938-21657960 TTAGAGCTGAAGGTTGTGTAGGG - Intergenic
1117422946 14:55565356-55565378 CGAGTTCTGATGGTTTTGTAAGG + Intronic
1117431380 14:55666606-55666628 CTAGTTCTGACACTTGTATATGG - Intronic
1120811028 14:88803626-88803648 TTAATTCTGGAGGTTGTGTATGG - Intergenic
1122643087 14:103172981-103173003 TTAGTTCTGAAGGTTCTGTTTGG - Intergenic
1125711995 15:41794641-41794663 CTGTTTCTGAAGCCTCTGTAAGG + Intronic
1127141123 15:55978268-55978290 CTAGTTCTGATTTTTGTGTTGGG - Intronic
1128992646 15:72273159-72273181 CTGGGTCTGAAGCTTGGGTTCGG + Intronic
1141003236 16:80327747-80327769 CTAGTTCTCAAGCCAATGTATGG + Intergenic
1144909354 17:18668145-18668167 CTGGTAGTGAAGCCTGTGTAGGG - Intronic
1149223998 17:54447454-54447476 CTCTTTTTGAAGCATGTGTATGG + Intergenic
1154013248 18:10593627-10593649 TTTGTTCTAAACCTTGTGTAGGG - Intergenic
1157144542 18:45148349-45148371 CCAGTTCTGAAGCTGTTGTAAGG + Intergenic
925865024 2:8219883-8219905 GCAGTTCTGGAGCTTGGGTATGG - Intergenic
926361065 2:12087851-12087873 CTAGTTTTCCAGCTTGTGGATGG - Intergenic
927159788 2:20246207-20246229 CTAGATATGAAGCTAGTGTTTGG + Intergenic
930643737 2:53881550-53881572 CAAGTTCAGAAGCTTGTGCAAGG + Intronic
933625359 2:84591647-84591669 CTATTTCTCAAGATTGTGTTGGG - Intronic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
938030112 2:127985027-127985049 CTAAATGTGAAGCTTGCGTAGGG - Intronic
942168835 2:173269624-173269646 CTAGCTCTGAAGCCTATTTAGGG - Intergenic
942300876 2:174561235-174561257 CTAAATCTGATGCTTATGTAAGG - Exonic
942877761 2:180822777-180822799 CTAGCTCTCAAACTTGTGAATGG + Intergenic
945315142 2:208362255-208362277 CTAGTTCTCTAGCTTGCATATGG + Intronic
945967438 2:216203625-216203647 CTAGATCTGGAGCTTCTGAAAGG - Intronic
1177333837 21:19698158-19698180 CTATTACTGAAGCTTGTTCAGGG + Intergenic
1178747627 21:35268220-35268242 CTAATTATCAAGCTTGTGAAGGG - Intronic
1179436862 21:41368330-41368352 CCATTTCTGAAGATTGTGCAGGG + Intronic
1184215169 22:43061848-43061870 CGAGATCTGAAGCATGAGTAGGG - Intronic
1184312768 22:43658745-43658767 CAACTTCTGAAGGTTGTGTAGGG + Intronic
1184991666 22:48174464-48174486 CTGCTCCTGAAGCTTATGTAGGG - Intergenic
949739681 3:7216733-7216755 ATACTTCTGAAGCCTGTTTAAGG + Intronic
949750932 3:7351927-7351949 CTCATTCTGTAGCTTGTGAATGG + Intronic
951020296 3:17775629-17775651 CTATTTCTGAAGCTAGGATATGG + Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956305495 3:67820122-67820144 CTAGTTCTGATGCCAGTGCAGGG + Intergenic
956331901 3:68119913-68119935 ATAGTTCTCAAACTTGAGTATGG - Intronic
959051220 3:101526684-101526706 CTAGGTTTCAAGCTTGTATAGGG + Intergenic
971175767 4:24281067-24281089 CTAGTTCCTAATCTTGTATATGG - Intergenic
971845668 4:31915359-31915381 CAAGATCTGATGCTTTTGTAAGG + Intergenic
973900610 4:55466213-55466235 CAAGTTCTGATGGTTTTGTAAGG + Intronic
973955841 4:56062104-56062126 CCAATTCTGAGGCTTGTGGAAGG + Intergenic
975343992 4:73273360-73273382 CGAGTTCTGAAGCCTTGGTAAGG - Intergenic
975466332 4:74713773-74713795 CCATTACTGAAGCTTGAGTAGGG - Intergenic
979283574 4:118895469-118895491 CAAATTCTGGAGCATGTGTATGG + Intronic
980270929 4:130582747-130582769 CTAGTTGTGAAAATTGGGTAGGG + Intergenic
980324140 4:131319544-131319566 CTGTTTCTTAAGCTTGGGTATGG + Intergenic
980487912 4:133483770-133483792 CAAGATCTGATGGTTGTGTAAGG + Intergenic
983811328 4:172065855-172065877 CCAGATCTGATGCTTGTATAAGG - Intronic
984848691 4:184131902-184131924 CTAGATCTCCAGCTTGTGGATGG - Intronic
986614795 5:9605059-9605081 CTAGTTCTTCAGCTTGCATATGG + Intergenic
989800076 5:45526587-45526609 CTTGTTCTGAACCTTGGGTTTGG + Intronic
991151478 5:63376138-63376160 CTATTGCTGAGGCTTGAGTAGGG + Intergenic
993616777 5:90122665-90122687 CTAGTTCTGGAGAATGTATAGGG - Intergenic
994160031 5:96547238-96547260 CTGGTTCTTCAGCTTGCGTATGG - Intronic
995583639 5:113624722-113624744 CTATTTCTGAAGCTAGGATATGG - Intergenic
997050360 5:130373042-130373064 CTGGTTCTCAAGCTTGCGTATGG - Intergenic
998111250 5:139504462-139504484 CTATTTCTGAAGCTAGGATATGG + Intergenic
999668569 5:153937747-153937769 CTAGTTCAGAAGTCTGTGGAGGG + Intergenic
1003767739 6:9260521-9260543 CAAGATCTGAAGTTTTTGTAAGG - Intergenic
1009386151 6:63085591-63085613 CTATTTCTGAAGCTAGGATATGG - Intergenic
1009818296 6:68765837-68765859 CTAGTCCGGGAGCTTTTGTAGGG - Intronic
1011763348 6:90592276-90592298 CTAGGTGTGGAGCTTGTGTTAGG - Intergenic
1014171024 6:118279339-118279361 CTCTTTCTGAAGCATTTGTAGGG + Intronic
1014461276 6:121698663-121698685 CTATGAATGAAGCTTGTGTAGGG - Intergenic
1014902181 6:126980102-126980124 CTATTATTGAAACTTGTGTAGGG - Intergenic
1015299419 6:131635529-131635551 CTTGTTCTGGACTTTGTGTAAGG - Intronic
1018186520 6:161269703-161269725 ATAGTTCTTAAGCTTCTTTAAGG + Intronic
1023279772 7:38557443-38557465 CAAGTTCTGATGGTTGTATAAGG + Intronic
1023397201 7:39762296-39762318 CTATTTCCAAAGCTTATGTAGGG - Intergenic
1024255280 7:47536240-47536262 GTTTTTCTGAAGCTTTTGTAAGG - Intronic
1027581430 7:80001133-80001155 CTAGATCTGATGCTTTTATAAGG - Intergenic
1031458645 7:122016951-122016973 CTGGTTCAGAAGATTTTGTATGG + Intronic
1032636430 7:133714081-133714103 CTAGTACTGATGCTGGTGTGAGG - Intronic
1034641568 7:152608094-152608116 TTAGTTCTGAAGCTCGTCTCTGG + Intergenic
1037394566 8:18428523-18428545 CTAGATCTGATGCTTTTATAAGG + Intergenic
1038222419 8:25623341-25623363 CTAGTTCTGAAAATGGTGAAGGG - Intergenic
1038476262 8:27870620-27870642 CTAGTTCTTGAACATGTGTATGG + Exonic
1041640915 8:60200477-60200499 ATGGTTCTGATGCTTATGTATGG - Intronic
1041913444 8:63114632-63114654 CAAGTCCTGAAGCTGGTGAAAGG + Intergenic
1044556820 8:93571535-93571557 CTGTTTCTTAAGCATGTGTAAGG - Intergenic
1052078940 9:24179686-24179708 CAAGATCTGAAGCTTTTATAAGG - Intergenic
1053606510 9:39665815-39665837 CTAGTTCCAATGCTTGTGTTGGG - Intergenic
1053864432 9:42422433-42422455 CTAGTTCCAATGCTTGTGTTGGG - Intergenic
1054247031 9:62676608-62676630 CTAGTTCCAATGCTTGTGTTGGG + Intergenic
1056394221 9:86166890-86166912 CAGGTTCTGAAGCTGGTTTATGG - Intergenic
1056466168 9:86857434-86857456 CTAGTTCTGTAGCTAGTCTATGG + Intergenic
1057380931 9:94566792-94566814 CAAGTTCAGATGCTTTTGTAAGG - Intronic
1058278156 9:103074127-103074149 CTAGATCTCAAGGTTTTGTAAGG + Intergenic
1061593754 9:131615459-131615481 CTCGGTCTGAAGCCTGTGCAGGG + Intronic
1186781623 X:12917755-12917777 CTAGTTTTGAAACTTCTCTAGGG - Intronic
1191995901 X:67094851-67094873 CTGGTTCTCAGGCTTGTGTGGGG + Intergenic
1194750303 X:97677206-97677228 CTAATTCTGGAGCTTGAGCAGGG - Intergenic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1200695165 Y:6352192-6352214 CTACTCCTGAAGCTAGGGTATGG - Intergenic
1201040112 Y:9822518-9822540 CTACTCCTGAAGCTAGGGTATGG + Intergenic