ID: 1074686644

View in Genome Browser
Species Human (GRCh38)
Location 10:115968132-115968154
Sequence ACCGTGCACACATTTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074686638_1074686644 8 Left 1074686638 10:115968101-115968123 CCATAAGCATCCTTACACAGGTC No data
Right 1074686644 10:115968132-115968154 ACCGTGCACACATTTCCAAGTGG No data
1074686643_1074686644 -2 Left 1074686643 10:115968111-115968133 CCTTACACAGGTCTTCGGGGGAC No data
Right 1074686644 10:115968132-115968154 ACCGTGCACACATTTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074686644 Original CRISPR ACCGTGCACACATTTCCAAG TGG Intergenic