ID: 1074687514

View in Genome Browser
Species Human (GRCh38)
Location 10:115974154-115974176
Sequence CCGAATATACAAATGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074687510_1074687514 13 Left 1074687510 10:115974118-115974140 CCATGGTCTCATCATTAGACATT No data
Right 1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074687514 Original CRISPR CCGAATATACAAATGGACAG TGG Intergenic
No off target data available for this crispr